BDP08
RESEARCH COMMUNICATION
A single Hox locus
in Drosophila produces functional microRNAs
from opposite DNA strands
Alexander Stark,1,2,6,8Natascha Bushati,3,6
Calvin H.Jan,4Pouya Kheradpour,1,2
Emily Hodges,5Julius Brennecke,5
David P.Bartel,4Stephen M.Cohen,3,7and Manolis Kellis1,9
1Broad Institute of Massachussetts Institute of Technology and Harvard University,Cambridge,Massachusetts02141, USA;2Computer Science and Artificial Intelligence Laboratory,Massachusetts Institute of Technology, Cambridge,Massachusetts02139,USA;3European Molecular Biology Laboratory,69117Heidelberg,Germany;4Department of Biology,Howard Hughes Medical Institute and Whitehead Institute for Biomedical Research,Massachusetts Institute of Technology Cambridge,Massachusetts02139,USA;5Watson School of Biological Sciences and Howard Hughes Medical Institute,Cold Spring Harbor Laboratory,
Cold Spring Harbor,New York11724,USA
MicroRNAs(miRNAs)are～22-nucleotide RNAs that are processed from characteristic precursor hairpins and pair to sites in messages of protein-coding genes to direct post-transcriptional repression.Here,we report that the miRNA iab-4locus in the Drosophila Hox cluster is transcribed convergently from both DNA strands,giving rise to two distinct functional miRNAs.Both sense and antisense miRNA products target neighboring Hox genes via highly conserved sites,leading to homeotic transfor-mations when ectopically expressed.We also report sense/antisense miRNAs in mouse and find antisense transcripts close to many miRNAs in both flies and mammals,suggesting that additional sense/antisense pairs exist.
Supplemental material is available at https://www.wendangku.net/doc/1c19026847.html,. Received September6,2007;revised version accepted November2,2007.
Hox genes are highly conserved homeobox-containing transcription factors crucial for development in animals (Lewis1978;for reviews,see McGinnis and Krumlauf 1992;Pearson et al.2005).Genetic analyses have identi-fied them as determinants of segmental identity that specify morphological diversity along the anteroposte-rior body axis.A striking conserved feature of Hox com-plexes is the spatial colinearity between Hox gene tran-scription in the embryo and the order of the genes along the chromosome(Duboule1998).Hox clusters also give rise to a variety of noncoding transcripts,including mi-croRNAs(miRNAs)mir-10and mir-iab-4/mir-196, which derive from analogous positions in Hox clusters in flies and vertebrates(Yekta et al.2004).miRNAs are～22-nucleotide(nt)RNAs that regulate gene expression post-transcriptionally(Bartel2004).They are transcribed as longer precursors and processed from characteristic pre-miRNA hairpins.In particular,Hox miRNAs have been shown to regulate Hox protein-coding genes by mRNA cleavage and inhibition of translation,thereby contrib-uting to the extensive regulatory connections within Hox clusters(Mansfield et al.2004;Yekta et al.2004; Hornstein et al.2005;Ronshaugen et al.2005).Several Hox transcripts overlap on opposite strands,providing evidence of extensive antisense transcription,including antisense transcripts for mir-iab-4in flies(Bae et al. 2002)and its mammalian equivalent mir-196(Mainguy et al.2007).However,the function of these transcripts has been elusive.Here we show that the iab4locus in Drosophila produces miRNAs from opposite DNA strands that can regulate neighboring Hox genes via highly conserved sites.We provide evidence that such sense/antisense miRNA pairs are likely employed in other contexts and a wide range of species.
Results and Discussion
Our examination of the antisense transcript that over-laps Drosophila mir-iab-4revealed that the reverse complement of the mir-iab-4hairpin folds into a hairpin reminiscent of miRNA precursors(Fig.1A).Moreover, 17sequencing reads from small RNA libraries of Dro-sophila testes and ovaries mapped uniquely to one arm of the iab-4antisense hairpin(Fig.1B).All reads were aligned at their5?end,suggesting that the mir-iab-4an-tisense hairpin is processed into a single mature miRNA in vivo,which we refer to as miR-iab-4AS.For compari-son,we found six reads consistent with the known miR-iab-4-5p(or miR-iab-4for short)and one read for its star sequence(miR-iab-4-3p).Interestingly,the relative abun-dance of mature miRNAs and star sequences for mir-iab-4AS(17:0)and mir-iab-4(6:1)reflects the thermody-namic asymmetry of the predicted miRNA/miRNA*du-plexes(Khvorova et al.2003;Schwarz et al.2003). Because they derived from complementary near palin-dromes,miR-iab-4and miR-iab-4AS had high sequence similarity,only differing in four positions at the3?region (Fig.1B).However,they differed in their5?ends,which largely determine miRNA target spectra(Brennecke et al.2005;Lewis et al.2005):miR-iab-4AS was shifted by 2nt,suggesting targeting properties distinct from those of miR-iab-4and other known Drosophila miRNAs. We confirmed robust transcription of mir-iab-4sense and antisense precursors by in situ hybridization to Dro-sophila embryos(Fig.1C).Both transcripts were detected in abdominal segments in the posterior part of the em-bryo,but intriguingly in nonoverlapping domains.As de-scribed previously(Bae et al.2002;Ronshaugen et al. 2005),mir-iab-4sense was expressed highly in abdomi-nal segments A5–A7,showing modulation in levels within the segments:abdominal-A(abd-A)-expressing cells(Fig.1D;Karch et al.1990;Macias et al.1990)ap-
[Keywords:Drosophila;miR-iab-4;Hox;antisense miRNAs]
6This authors contributed equally to this work.
7Present address:Temasek Life Sciences Laboratory,The National Uni-
versity of Singapore,Singapore117604.
Corresponding authors.
8E-MAIL alex.stark@https://www.wendangku.net/doc/1c19026847.html,;FAX(617)253-7512.
9E-MAIL manoli@https://www.wendangku.net/doc/1c19026847.html,;FAX(617)253-7512.
Article is online at https://www.wendangku.net/doc/1c19026847.html,/cgi/doi/10.1101/gad.1613108.
8GENES&DEVELOPMENT22:8–13?2008by Cold Spring Harbor Laboratory Press ISSN0890-9369/08;https://www.wendangku.net/doc/1c19026847.html,
peared to have more mir-iab-4,whereas Ultrabithorax (Ubx )-positive cells appeared to have little or none (Fig.1D;Ronshaugen et al.2005).In contrast,mir-iab-4AS transcription was detected in the segments A8and A9,where Abdominal-B (Abd-B )is known to be expressed (Fig.1C;Yoder and Carroll 2006).Primary transcripts for mir-iab-4and mir-iab-4AS were also detected by strand-specific RT –PCR in larvae,pupae,and male and female adult flies (Supplemental Fig.S1),suggesting that both miRNAs are expressed throughout fly development.To assess the possible biological roles of the two iab-4miRNAs,we examined fly genes for potential target sites by searching for conserved matches to the seed region of the miRNAs (Lewis et al.2005).We found highly con-served target sites for miR-iab-4AS in the 3?untranslated regions (UTRs)of several Hox genes that are proximal to the iab-4locus and are expressed in the neighboring more anterior embryonic segments:abd-A ,Ubx ,and Antennapedia (Antp )have four,five,and two seed sites,respectively,most of which are conserved across 12Dro-sophila species that diverged 40million years ago (Fig.2A;Supplemental Fig.S2;Drosophila 12Genomes Con-sortium 2007;Stark et al.2007a).More than two highly conserved sites for one miRNA is exceptional for fly 3?UTRs,placing these messages among the most confi-dently predicted miRNA targets and suggesting that they might be particularly responsive to the presence of the miRNA.The strong predicted targeting of proximal Hox genes was reminiscent of previously characterized miR-iab-4targeting of Ubx in flies and miR-196targeting of HoxB8in vertebrates (Mansfield et al.2004;Yekta et al.2004;Hornstein et al.2005;Ronshaugen et al.2005).To test whether miR-iab4AS is functional and can di-rectly target abd-A and Ubx ,we constructed Luciferase reporters carrying the corresponding wild-type 3?UTRs and control 3?UTRs in which each seed site was dis-rupted by point substitutions.mir-iab-4AS potently re-pressed reporter activity for abd-A and Ubx (Fig.2B).This repression was specific to the miR-iab-4AS seed sites,as expression of the control reporters with mutated sites was not affected.We also tested whether mir-iab-4AS reduced expression of a Luciferase reporter with the Abd-B 3?UTR,which has no seed sites.As expected,mir-iab-4AS expression did not affect reporter activity,
consistent with a model where miRNAs do not target genes that are coexpressed at high levels (Farh et al.2005;Stark et al.2005).In addition to demonstrating specific repression dependent on the predicted target sites,these assays confirmed the processing of the mir-iab-4AS hair-pin into a functional mature miRNA.
If miR-iab-4AS were able to potently
down-regulate
Figure 2.miR-iab-4AS targets neighboring Hox genes.(A )miR-iab-4AS has five 3?UTR seed sites (red)in Ubx ,four in abd-A ,and two in Antp of which three,four,and one are conserved across 12Dro-sophila species,respectively (Supplemental Fig.S2).miR-iab-4has one 3?UTR seed site (blue)in Ubx and two in Antp,while abd-A has no such sites.(B )miR-iab-4AS mediates repression of luciferase re-porters through complementary seed sites in 3?UTRs from abd-A and Ubx ,but not Abd-B (Antp was not tested).Luciferase activity in S2cells cotransfected with plasmid expressing the indicated miRNA with either wild-type luciferase reporters or mutant report-ers bearing a single point mutation in the seed.Bars represent geo-metric means from 16replicates,normalized to the transfection control and noncognate miRNA control (let-7;see Materials and Methods).Error bars represent the fourth largest and smallest values from 16replicates ([*]P <0.0001,Wilcoxon rank-sum
test).
Figure 1.Drosophila iab-4contains sense and antisense miRNAs.(A )mir-iab-4sense and antisense sequences can adopt fold-back stem –loop structures characteristic for miRNA precursors (structure predictions by Mfold [Zuker 2003];mature miRNAs shaded in blue [miR-iab-4]and red [miR-iab-4AS]).(B )Solexa sequencing reads that uniquely align to the mir-iab-4hairpin sequence (top )or its reverse complement (bottom ;numbers on the right indicate the cloning frequency for each sequence).The mature miRNAs have very similar sequences that are shifted by 2nt and are different in only four additional positions.(C )Expression of primary transcripts for mir-iab-4(blue)and mir-iab-4AS (red)in nonoverlapping abdominal segments determined by in situ hybridization (lateral [left panel]and dorsal [right panel]view of embryonic stage 11,anterior is to the left).(D )Lateral views of stage 10/11embryos in which Ubx and abd-A proteins are visualized (anterior is to the left,and dorsal is upwards).
Functional sense/antisense microRNAs
GENES &DEVELOPMENT 9
Ubx in the fly,its misexpression should result in a Ubx loss-of-function phenotype,a line of reasoning that has often been used to study the functions and regulatory relationships of Hox genes.Ubx is expressed throughout the haltere imaginal disc,where it represses wing-spe-cific genes and specifies haltere identity (Weatherbee et al.1998).When we expressed mir-iab-4AS in the haltere imaginal disc under bx-Gal4control,a clear homeotic transformation of halteres to wings was observed (Fig.3).The halteres developed sense organs characteristic of the wing margin and their size increased severalfold,fea-tures typical of transformation to wing (Weatherbee et al.1998).Consistent with the increased number of miR-iab4AS target sites,the transformation was stronger than that reported for expression of iab-4(Ronshaugen et al.2005),for which we confirmed changes in morphology but did not find wing-like growth (Fig.3D).
We conclude that both strands of the iab-4locus are expressed in nonoverlapping embryonic domains and that each transcript produces a functional miRNA in vivo.In particular,the novel mir-iab-4AS is able to strongly down-regulate neighboring Hox genes.Interest-ingly,vertebrate mir-196,which lies at an analogous po-sition in the vertebrate Hox clusters,is transcribed in the same direction as mir-iab-4AS and most other Hox genes,and targets homologs of both abd-A and Ubx (Mansfield et al.2004;Yekta et al.2004;Hornstein et al.2005).With its shared transcriptional orientation and ho-mologous targets,mir-iab-4AS appears to be the func-tional equivalent of mir-196.
The expression patterns and regulatory connections between Hox genes and the two iab-4miRNAs show an intriguing pattern in which the miRNAs appear to rein-force Hox gene-mediated transcriptional regulation (Fig.4A).In particular,miR-iab-4AS would reinforce the pos-terior expression boundary of abd-A ,Ubx ,and Antp ,supporting their transcriptional repression by Abd-B .mir-iab-4appears to support abd-A -and Abd-B -medi-ated repression of Ubx ,reinforcing the abd-A /Ubx ex-pression domains and the posterior boundary of Ubx ex-pression.Furthermore,both iab-4miRNAs have con-served target sites in Antp ,which is also repressed by Abd-B ,abd-A ,and Ubx .The iab-4miRNAs thus appear to support the established regulatory hierarchy among Hox transcription factors,which exhibits “posterior prevalence,”in that more posterior Hox genes repress more anterior ones and are dominant in specifying seg-ment identity (for reviews,see McGinnis and Krumlauf 1992;Pearson et al.2005).Interestingly,Abd-B and mir-iab-4AS are expressed in the same segments,and the majority of cis -regulatory elements controlling Abd-B expression are located 3?of Abd-B (Boulet et al.1991).This places them near the inferred transcription start of mir-iab-4AS ,where they potentially direct the coexpres-sion of these genes.Similarly,abd-A and mir-iab-4may be coregulated as both are transcribed divergently,po-tentially under the control of shared upstream elements.Our data demonstrate the transcription and processing of sense and antisense mir-iab-4into functional miRNAs with highly conserved functional target sites in neighboring Hox genes.In an accompanying study (Bender 2008),genetic and molecular analyses in mir-iab-4mutant Drosophila revealed that the proposed regulation of Ubx by both sense and antisense miRNAs occurs under physiological conditions and,in particular,the regulation by miR-iab-4AS is required for normal de-velopment.These lines of evidence establish miR-iab-4AS as a novel Hox gene,being expressed from within the Hox cluster and regulating Hox genes during devel-opment.
The genomic arrangement of two miRNAs that are expressed from the same locus but on different
strands
Figure 3.Misexpression of miR-iab-4AS transforms halteres to wings.(A ,B )Overview of an adult wild-type Drosophila (B )and an adult expressing mir-iab-4AS using bx -Gal4(A ).The halteres,balancing organs of the third thoracic segment,are indicated by arrows.(C )Wild-type haltere.(D )Expression of mir-iab-4using bx-Gal4induces a mild haltere-to-wing transformation.Sensory bristles characteristic of wild-type wing margins (shown in B ?)are indicated by an arrow.(E )Expression of mir-iab-4AS using bx-Gal4induces a strong haltere-to-wing transfor-mation,displaying the triple row of sensory bristles (inset )normally seen in wild-type wings (shown in B ?).Note that C –E are at the same magnification.
Stark et al.
10GENES &DEVELOPMENT
might provide a simple and efficient means to create nonoverlapping miRNA expression domains (Fig.4B).Such sense/antisense miRNAs could restrict each oth-er ’s transcription,either by direct transcriptional inter-ference,as shown for overlapping convergently tran-scribed genes (Shearwin et al.2005;Hongay et al.2006),or post-transcriptionally,possibly via RNA –RNA du-plexes formed by the complementary transcripts.Sense/antisense miRNAs would usually differ at their 5?ends and thereby target distinct sets of genes,which might help define and establish sharp boundaries between ex-pression domains.Coupled with feedback loops or co-regulation of miRNAs and genes in cis or trans ,this arrangement could provide a powerful regulatory switch.The iab-4miRNAs might be a special case of tight regu-latory integration in which miRNAs and proximal genes appear coregulated transcriptionally in cis and repress each other both transcriptionally and post-transcription-ally.
It is perhaps surprising that no antisense miRNA had been found previously,even though,for example,the intriguing expression pattern of the iab-4transcripts had been reported nearly two decades ago (Cumberledge et al.1990;Bae et al.2002),and iab-4lies in one of the most extensively studied regions of the Drosophila genome.The frequent occurrence of antisense transcripts (Yelin et al.2003;Katayama et al.2005)suggests that more antisense miRNAs might exist.Indeed,up to 13%of known Drosophila ,20%of mouse,and 31%of human
miRNAs are located in introns of host genes transcribed on the opposite strand or are within 50nt of antisense ESTs or cDNAs (Supplemental Table S1).These include an antisense transcript overlapping human mir-196(see also Mainguy et al.2007).However,because of the con-tribution of noncanonical base pairs,particularly G:U pairs that become less favorable A:C in the antisense strand,many miRNA antisense transcripts will not fold into hairpin structures suitable for miRNA biogenesis,which explains the propensity of miRNA gene predic-tions to identify the correct strand (Lim et al.2003).Nonetheless,in a recent prediction effort,22sequences reverse-complementary to known Drosophila miRNAs showed scores seemingly compatible with miRNA pro-cessing (Stark et al.2007b).Deep sequencing of small RNA libraries from Drosophila confirmed the processing of small RNAs from four of these high-scoring antisense candidates (Ruby et al.2007),and the ovary/testes librar-ies used here showed antisense reads for an additional Drosophila miRNA (mir-312)(see Supplemental Tables S2,S3).In addition,using high-throughput sequencing of small RNA libraries from mice,we found sequencing reads that uniquely matched the mouse genome in loci antisense to 10annotated mouse miRNAs.Eight of the inferred antisense miRNAs were supported by multiple independent reads,and two of them had reads from both the mature miRNA and the star sequence (Supplemental Table S2).These results suggest that sense/antisense miRNAs could be more generally employed in diverse contexts and in species as divergent as flies and mam-mals.
Materials and methods
Plasmids
3?UTRs were amplified from Drosophila melanogaster genomic DNA and cloned in pCR2.1for site-directed mutagenesis.The following primer pairs were used to amplify the indicated 3?UTR:abd-A (tc tagaGCGGTCAGCAAAGTCAACTC;gtcgacATGGATGGGTTCTCGT TGCAG),Ubx (tctagaATCCTTAGATCCTTAGATCCTTAG;ctcgag ATGGTTTGAATTTCCACTGA),and Abd-B (tctagaGCCACCACCT GAACCTTAG;aactcgagCGGAGTAATGCGAAGTAATTG).Quick-Change multisite-directed mutagenesis was used to mutate all miR-iab-4AS seed sites from ATACGT to ATAGGT,per the manufacturer ’s di-rections (Stratagene).Wild-type and mutated 3?UTRs were subcloned into pCJ40between SacI and NotI sites to make Renilla luciferase re-porters.Plasmid pCJ71contains the abd-A wild-type 3?UTR,pCJ72con-tains the Ubx wild-type 3?UTR,pCJ74contains the Abd-B wild-type 3?UTR,pCJ75contains the abd-A mutated 3?UTR,and pCJ76contains the Ubx mutated 3?UTR fused to Renilla luciferase.The control let-7ex-pression vector was obtained by amplifying let-7from genomic DNA with primers 474base pairs (bp)upstream of and 310bp downstream from the let-7hairpin and cloning it into pMT-puro.To express miR-iab-4and miR-iab-4AS,a 430-bp genomic fragment containing the miR-iab-4hairpin was cloned,in either direction,downstream from the tu-bulin promoter as described in Stark et al.(2005).For the UAS-miR-iab-4and UAS-miR-iab-4AS constructs,the same 430-bp genomic fragment containing the miR-iab-4hairpin was cloned downstream from pUAST-DSred2(Stark et al.2003)in either direction.
Reporter assays
For the luciferase assays,2ng of p2129(firefly luciferase),4ng of Renilla reporter,48ng of miRNA expression plasmid,and 48ng of p2032(GFP)were cotransfected with 0.3μL Fugene HD per well of a 96-well plate.Twenty-four hours after transfection,expression of Renilla luciferase was induced by addition of 500μM CuSO 4to the culture media.Twenty-four hours after induction,reporter activity was measured with the Dual-Glo luciferase kit (Promega),per the manufacturer ’s instructions on a Tecan Safire II plate
reader.
Figure 4.Regulation of gene expression by antisense miRNAs.(A )miRNA-mediated control in the Drosophila Hox cluster.Schematic representation of the Drosophila Hox cluster (Antennapedia and Bithorax complex)with miRNA target interactions (check marks represent experimentally validated targets).miR-iab-4(blue)and miR-iab-4AS (red)target anterior neighboring Hox genes and miR-10(black)targets posterior Sex-combs-reduced (Scr )(Brennecke et al.2005).abd-A and mir-iab-4and Abd-B and mir-iab-4AS might be coregulated from shared control elements (cis ).Note that mir-iab-4AS is expressed in the same direction as most other Hox genes and its mammalian equivalent,mir-196.(B )General model for defining different expression domains with pairs of antisense miRNAs (black).Different transcription factor(s)activate the transcription of miRNAs and genes in each of the two domains separately (green lines).Both miRNAs might inhibit each other by transcriptional interference or post-transcriptionally (vertical red lines),leading to essentially nonoverlapping expression and activity of both miRNAs.Further,both miRNAs likely target distinct sets of genes (diagonal red lines),potentially re-enforcing the difference between the two expression domains.
Functional sense/antisense microRNAs
GENES &DEVELOPMENT 11
The ratio of Renilla:firefly luciferase activity was measured for each well.To calculate fold repression,the ratio of Renilla:firefly for reporters cotransfected with let-7was set to1.The Wilcoxon rank-sum test was used to assess the significance of changes in fold repression of wild-type reporters compared with mutant reporters.Geometric means from16 transfections representing four replicates of four independent transfec-tions are shown.Error bars represent the fourth highest and lowest values of each set.
Drosophila strains
UAS-miR-iab-4and UAS-miR-iab-4AS flies were generated by injection of the corresponding plasmids into w1118embryos.bx MS1096-GAL4flies were obtained from the Bloomington Stock Center.
In situ hybridization and protein stainings
Double in situ hybridization for the miRNA primary transcripts was performed as described in Stark et al.(2005).Probes were generated using PCR on genomic DNA with primers TCAGAGCATGCAGAGACAT AAAG,TTGTAGATTGAAATCGGACACG for iab-4sense and ATTT TACTGGGTGTCTGGGAAAG,TAGAAACTGAGACGGAGAAGCAG for iab-4antisense.Protein stainings were performed as described in Patel (1994).Antibodies used were mouse anti-Ubx(1:30),mouse anti-abd-A (1:5),and HRP-conjugated goat anti-mouse(Dianova,1:3000).
RT–PCRs
Total RNA was isolated using Trizol(Invitrogen),treated with RQI DNase(Promega),and used for strand-specific cDNA synthesis with Su-perScript III(Invitrogen).Primers for cDNA synthesis were CATATAA CAAAGTGCTACGTG(iab-4sense)and CTTTATCTGCATTTG GATCCG(iab-4antisense).Both primers were used for subsequent am-plification.
Small library sequencing
Drosophila small RNAs were cloned from adult ovaries and testes as described previously(Brennecke et al.2007)and sequenced using Solexa sequencing.A total of657,251sequencing reads uniquely matched known Drosophila miRNAs(Rfam release9.2),and the69miRNAs with unique matches had1011matches on average(Stark et al.2007b).Two miRNAs had unique matches to the antisense hairpin(Supplemental Tables S2,S3).Mouse small RNAs were cloned from wild-type and c-kit mutant ovaries(Supplemental Table S4;G.Hannon,https://www.wendangku.net/doc/1c19026847.html,m.)and from Comma-Dbgeo cells,a murine mammary epithelial cell line(Ibarra et al.2007),and were sequenced using Solexa sequencing.A total of 4,217,883reads uniquely matched known mouse miRNAs(Rfam release 9.2),and the286miRNAs with unique reads showed256reads on aver-age.Sequencing reads matching to the plus and minus strand of known mouse miRNAs with antisense reads are listed in Supplemental Ta-ble S3.
Multiple sequence alignments and target site prediction
The multiple sequence alignments for the indicated Hox3?UTRs were obtained from the University of California at Santa Cruz(UCSC)genome browser(Kent et al.2002)and were slightly manually adjusted.We pre-dicted target sites according to Lewis et al.(2005)by searching for3?UTR seed sites(reverse-complementary to miRNA positions2–8or matching to“A”+reverse complement of miRNA positions2–7).
Antisense transcripts near known miRNAs
To assess the fraction of Drosophila,human,and mouse miRNAs that are also putatively transcribed on both strands and might give rise to antisense miRNAs,we determined the number of miRNAs that are near known transcripts on the opposite strand.We obtained the coordinates of all introns of protein-coding genes and all mapped ESTs or cDNAs for the three species from the UCSC genome browser(Kent et al.2002).We intersected them with the miRNA coordinates from Rfam(release9.2; Griffiths-Jones et al.2006),requiring miRNAs and transcripts to be on opposite strands and at a distance of at most50nt.For each miRNA,we recorded the number of antisense transcripts and their identifiers.Note that some of the transcripts might have been mapped to more than one place in the genome,such that the intersection represents an upper es-timate based on the currently known transcripts.Acknowledgments
We thank Greg Hannon for providing Solexa sequencing data and sup-port,Juerg Mueller for the anti-Ubx antibody,Thomas Sandmann for Drosophila embryos,and Sandra Mueller for preparing transgenic flies. We thank the Drosophila genome sequencing centers and the UCSC genome browser for access to the12Drosophila multiple sequence align-ments prior to publication,and Welcome Bender for sharing data prior to publication.A.S.was partly supported by a post-doctoral fellowship from the Schering AG and partly by a post-doctoral fellowship from the Hu-man Frontier Science Program Organization(HFSPO).C.H.J.is an NSF graduate fellow.J.B.thanks the Schering AG for a post-doctoral fellow-ship.This work was also partially supported by a grant from the NIH. References
Bae,E.,Calhoun,V.C.,Levine,M.,Lewis,E.B.,and Drewell,R.A.2002.
Characterization of the intergenic RNA profile at abdominal-A and Abdominal-B in the Drosophila bithorax complex.Proc.Natl.Acad.
Sci.99:16847–16852.
Bartel,D.P.2004.MicroRNAs:Genomics,biogenesis,mechanism,and function.Cell116:281–297.
Bender,W.2008.MicroRNAs in the Drosophila bithorax complex.Genes &Dev.(this issue),doi:10.1101/gad.1614208.
Boulet,A.M.,Lloyd,A.,and Sakonju,S.1991.Molecular definition of the morphogenetic and regulatory functions and the cis-regulatory ele-ments of the Drosophila Abd-B homeotic gene.Development111: 393–405.
Brennecke,J.,Stark,A.,Russell,R.B.,and Cohen,S.M.2005.Principles of microRNA-target recognition.PLoS Biol.3:e85.doi:10.1371/ journal.pbio.0030085.
Brennecke,J.,Aravin,A.A.,Stark,A.,Dus,M.,Kellis,M.,Sachidanan-dam,R.,and Hannon,G.J.2007.Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila.Cell128: 1089–1103.
Cumberledge,S.,Zaratzian,A.,and Sakonju,S.1990.Characterization of two RNAs transcribed from the cis-regulatory region of the abd-A domain within the Drosophila bithorax complex.Proc.Natl.Acad.
Sci.87:3259–3263.
Drosophila12Genomes Consortium2007.Evolution of genes and ge-nomes on the Drosophila phylogeny.Nature450:203–218. Duboule,D.1998.Vertebrate hox gene regulation:Clustering and/or colinearity?Curr.Opin.Genet.Dev.8:514–518.
Farh,K.K.,Grimson,A.,Jan,C.,Lewis,B.P.,Johnston,W.K.,Lim,L.P., Burge,C.B.,and Bartel,D.P.2005.The widespread impact of mam-malian microRNAs on mRNA repression and evolution.Science310: 1817–1821.
Griffiths-Jones,S.,Grocock,R.J.,van Dongen,S.,Bateman,A.,and En-right,A.J.2006.miRBase:MicroRNA sequences,targets and gene nomenclature.Nucleic Acids Res.34(Database issue):D140–D144.
doi:10.1093/nar/gkj112.
Hongay,C.F.,Grisafi,P.L.,Galitski,T.,and Fink,G.R.2006.Antisense transcription controls cell fate in Saccharomyces cerevisiae.Cell 127:735–745.
Hornstein,E.,Mansfield,J.H.,Yekta,S.,Hu,J.K.,Harfe,B.D.,McManus, M.T.,Baskerville,S.,Bartel,D.P.,and Tabin,C.J.2005.The mi-croRNA miR-196acts upstream of Hoxb8and Shh in limb develop-ment.Nature438:671–674.
Ibarra,I.,Erlich,Y.,Muthuswamy,S.K.,Sachidanandam,R.,and Han-non,G.J.2007.A microRNA fingerprint of mammary epithelial stem cells.Genes&Dev.21:3238–3243.
Karch,F.,Bender,W.,and Weiffenbach,B.1990.abdA expression in Drosophila embryos.Genes&Dev.4:1573–1587.
Katayama,S.,Tomaru,Y.,Kasukawa,T.,Waki,K.,Nakanishi,M.,Na-kamura,M.,Nishida,H.,Yap,C.C.,Suzuki,M.,Kawai,J.,et al.2005.
Antisense transcription in the mammalian transcriptome.Science 309:1564–1566.
Kent,W.J.,Sugnet,C.W.,Furey,T.S.,Roskin,K.M.,Pringle,T.H.,Zahler,
A.M.,and Haussler,D.2002.The human genome browser at UCSC.
Genome Res.12:996–1006.
Khvorova,A.,Reynolds,A.,and Jayasena,S.D.2003.Functional siRNAs and miRNAs exhibit strand bias.Cell115:209–216.
Lewis, E.B.1978.A gene complex controlling segmentation in Dro-
Stark et al.
12GENES&DEVELOPMENT
Functional sense/antisense microRNAs sophila.Nature276:565–570.
Lewis,B.P.,Burge,C.B.,and Bartel,D.P.2005.Conserved seed pairing,
often flanked by adenosines,indicates that thousands of human
genes are microRNA targets.Cell120:15–20.
Lim,L.P.,Lau,N.C.,Weinstein, E.G.,Abdelhakim, A.,Yekta,S.,
Rhoades,M.W.,Burge,C.B.,and Bartel,D.P.2003.The microRNAs
of Caenorhabditis elegans.Genes&Dev.17:991–1008.
Macias,A.,Casanova,J.,and Morata,G.1990.Expression and regulation
of the abd-A gene of Drosophila.Development110:1197–1207.
Mainguy,G.,Koster,J.,Woltering,J.,Jansen,H.,and Durston,A.2007.
Extensive polycistronism and antisense transcription in the mamma-
lian hox clusters.PLoS ONE2:e356.doi:10.1371/journal.pone.
0000356.
Mansfield,J.H.,Harfe, B.D.,Nissen,R.,Obenauer,J.,Srineel,J.,
Chaudhuri,A.,Farzan-Kashani,R.,Zuker,M.,Pasquinelli,A.E.,Ru-
vkun,G.,et al.2004.MicroRNA-responsive‘sensor’transgenes un-
cover Hox-like and other developmentally regulated patterns of ver-
tebrate microRNA expression.Nat.Genet.36:1079–1083.
McGinnis,W.and Krumlauf,R.1992.Homeobox genes and axial pat-
terning.Cell68:283–302.
Patel,N.H.1994.Imaging neuronal subsets and other cell types in whole-
mount Drosophila embryos and larvae using antibody probes.Meth-
ods Cell Biol.44:445–487.
Pearson,J.C.,Lemons,D.,and McGinnis,W.2005.Modulating Hox gene
functions during animal body patterning.Nat.Rev.Genet.6:893–
904.
Ronshaugen,M.,Biemar,F.,Piel,J.,Levine,M.,and Lai,E.C.2005.The
Drosophila microRNA iab-4causes a dominant homeotic transfor-
mation of halteres to wings.Genes&Dev.19:2947–2952.
Ruby,J.G.,Stark,A.,Johnston,W.K.,Kellis,M.,Bartel,D.P.,and Lai,
E.C.2007.Evolution,biogenesis,expression,and target predictions of
a substantially expanded set of Drosophila microRNAs.Genome Res.
doi:10.1101/gr.6597907.
Schwarz,D.S.,Hutvagner,G.,Du,T.,Xu,Z.,Aronin,N.,and Zamore,
P.D.2003.Asymmetry in the assembly of the RNAi enzyme com-
plex.Cell115:199–208.
Shearwin,K.E.,Callen,B.P.,and Egan,J.B.2005.Transcriptional inter-
ference—A crash course.Trends Genet.21:339–345.
Stark,A.,Brennecke,J.,Russell,R.B.,and Cohen,S.M.2003.Identifica-
tion of Drosophila microRNA targets.PLoS Biol.1:E60.doi:10.1371/
journal.pbio.0000060.
Stark,A.,Brennecke,J.,Bushati,N.,Russell,R.B.,and Cohen,S.M.2005.
Animal microRNAs confer robustness to gene expression and have a
significant impact on3?UTR evolution.Cell123:1133–1146.
Stark,A.,Lin,M.F.,Kheradpour,P.,Pedersen,J.S.,Parts,L.,Carlson,
J.W.,Crosby,M.A.,Rasmussen,M.D.,Roy,S.,Deoras,A.N.,et al.
2007a.Discovery of functional elements in12Drosophila genomes
using evolutionary signatures.Nature450:219–232.
Stark,A.,Kheradpour,P.,Parts,L.,Brennecke,J.,Hodges,E.,Hannon,
G.J.,and Kellis,M.2007b.Systematic discovery and characterization
of fly microRNAs using12Drosophila genomes.Genome Res.doi:
10.1101/gr.6593807.
Weatherbee,S.D.,Halder,G.,Kim,J.,Hudson,A.,and Carroll,S.1998.
Ultrabithorax regulates genes at several levels of the wing-patterning
hierarchy to shape the development of the Drosophila haltere.Genes
&Dev.12:1474–1482.
Yekta,S.,Shih,I.H.,and Bartel,D.P.2004.MicroRNA-directed cleavage
of HOXB8mRNA.Science304:594–596.
Yelin,R.,Dahary,D.,Sorek,R.,Levanon,E.Y.,Goldstein,O.,Shoshan,
A.,Diber,A.,Biton,S.,Tamir,Y.,Khosravi,R.,et al.2003.Wide-
spread occurrence of antisense transcription in the human genome.
Nat.Biotechnol.21:379–386.
Yoder,J.H.and Carroll,S.B.2006.The evolution of abdominal reduction
and the recent origin of distinct Abdominal-B transcript classes in
Diptera.Evol.Dev.8:241–251.
Zuker,M.2003.Mfold Web server for nucleic acid folding and hybrid-
ization prediction.Nucleic Acids Res.31:3406–3415.
GENES&DEVELOPMENT13