Toll-like receptor 10 is involved in induction of innate immune responses
Toll-like receptor10is involved in induction of innate immune responses to influenza virus infection
Suki M.Y.Lee a,b,Kin-Hang Kok c,Martial Jaume a,Timothy K.W.Cheung a,Tsz-Fung Yip a,Jimmy https://www.wendangku.net/doc/3614898553.html,i a,Yi Guan b, Robert G.Webster d,1,Dong-Yan Jin c,and J.S.Malik Peiris a,b,1
a University of Hong Kong-Pasteur Research Pole and Centre of Influenza Research,School of Public Health,
b State Key Laboratory of Emerging Infectious Diseases,and
c Department of Biochemistry,Li Ka Shing Faculty of Medicine,University of Hong Kong,Hong Kong Special Administrative Region,China; an
d d Department of Infectious Diseases,St.Jud
e Children’s Research Hospital,Memphis,TN38105
Contributed by Robert G.Webster,January29,2014(sent for review August8,2013)
Toll-like receptors(TLRs)play key roles in innate immune recognition of pathogen-associated molecular patterns of invading microbes. Among the10TLR family members identified in humans,TLR10re-mains an orphan receptor without known agonist or function.TLR10 is a pseudogene in mice and mouse models are noninformative in this https://www.wendangku.net/doc/3614898553.html,ing influenza virus infection in primary human peripheral blood monocyte-derived macrophages and a human monocytic cell line,we now provide previously unidentified evi-dence that TLR10plays a role in innate immune responses follow-ing viral infection.Influenza virus infection increased TLR10 expression and TLR10contributed to innate immune sensing of viral infection leading to cytokine induction,including proinflammatory cytokines and interferons.TLR10induction is more pronounced following infection with highly pathogenic avian influenza H5N1 virus compared with a low pathogenic H1N1virus.Induction of TLR10by virus infection requires active virus replication and de novo protein synthesis.Culture supernatants of virus-infected cells modestly up-regulate TLR10expression in nonvirus-infected cells.Signaling via TLR10was activated by the functional RNA–protein complex of influenza virus leading to robust induction of cytokine expression.Taken together,our findings identify TLR10 as an important innate immune sensor of viral infection and its role in innate immune defense and immunopathology following viral and bacterial pathogens deserves attention.
P attern recognition receptors(PRRs)play a key role in rec-ognizing pathogen-associated molecular patterns(PAMPs) on microbes leading to the initiation and orchestration of innate and adaptive immune responses.Toll-like receptors(TLRs)are an important group of PRRs;their activation leads to the in-duction of interferons(IFNs)and cytokines,which play a major role in host defense and pathogenesis(1).TLRs are expressed on a variety of cell types,including macrophages(2),and play a key role in the innate immune recognition of viruses,e.g.,influenza viruses(3,4).TLR signaling activates a cascade of intermediates, including adaptor proteins,protein kinases,and effector tran-scription factors,which result in the production of type I IFN (e.g.,IFN-β)inducing an antiviral state in cells,providing an important first line of defense against virus infection.Other proinflammatory cytokines,e.g.,tumor necrosis factor(TNF)-αand interleukin(IL)-6are also triggered by TLR signaling and are important determinants of the balance between beneficial host innate immune responses and immunopathology. Presently there are10known TLR members,TLRs1–10, identified in humans.TLRs are a family of transmembrane recep-tors consisting of an N-terminal extracellular domain(ECD)with multiple leucine-rich repeats,linked by a transmembrane domain (TMD)to a cytosolic signaling domain called Toll/IL-1R(TIR) (5).Among the10different TLRs,TLR10remains an orphan receptor without a known agonist or function.A major constraint to research on TLR10has been the lack of a suitable mouse model because TLR10is a pseudogene in mice due to sequence gaps and multiple retroviral insertions(6).
Recently,studies have reported genetic polymorphisms of TLR10in humans in association with diverse diseases,including Crohn’s disease(7),asthma(8),urothelial bladder cancer(9),
and nasopharyngeal cancer(10).Furthermore,TLR10expres-
sion is also reported to be induced in response to reactive oxygen species in hypoxic cells(11).These data may suggest a role of
TLR10in the pathogenesis of different diseases,but the mech-anisms remain obscure.
One study has suggested that TLR10cooperates with TLR2in sensing triacylated lipopeptides and recruits myeloid differenti-
ation factor88(MyD88)to the activated receptor complex(12). However,they showed that native TLR10coexpressed with
TLR2as a heterodimer in a human colonic epithelial cell line did
not respond to lipopeptide stimulation.Response only occurred
in an artificial situation,when TLR2was coexpressed with a chimeric receptor,in which the ECD and TMD of TLR1was replaced with that of TLR10.
Macrophages are key sentinel cells of host defense and are abundantly found in all tissues of the body,including the alveolar spaces of the lung.Our previous studies have demonstrated that influenza A virus replicates and induces proinflammatory cyto-
kine responses and paracrine cytokine cascades in human periph-
eral blood monocyte-derived macrophages and alveolar epithelial
cells(13–15).
Defining the mechanisms of host defense after virus infection
is important for the development of novel therapeutic
options
Author contributions:S.M.Y.L.,K.-H.K.,Y.G.,R.G.W.,D.-Y.J.,and J.S.M.P.designed research;S.M.Y.L.,K.-H.K.,M.J.,T.K.W.C.,T.-F.Y.,and J.C.C.L.performed research;
D.-Y.J.and J.S.M.P.contributed new reagents/analytic tools;S.M.Y.L.,K.-H.K.,M.J.,
and T.K.W.C.analyzed data;and S.M.Y.L.,R.G.W.,and J.S.M.P.wrote the paper.
The authors declare no conflict of interest.
1To whom correspondence may be addressed.E-mail:robert.webster@https://www.wendangku.net/doc/3614898553.html, or
malik@hku.hk.
This article contains supporting information online at https://www.wendangku.net/doc/3614898553.html,/lookup/suppl/doi:10.
1073/pnas.1324266111/-/DCSupplemental.
I
M
M
U
N
O
L
O
G
Y
(16).In this study,we report the induction of TLR10expression
in human macrophages in response to influenza A virus infection.
Influenza viruses are subtyped on the hemagglutinin(H)and
neuraminidase(N)https://www.wendangku.net/doc/3614898553.html,pared with seasonal influenza
virus H1N1,the highly pathogenic avian influenza virus H5N1is
a more potent inducer of TLR10expression.TLR10was found
to be involved in a novel innate immune sensing and signaling
pathway contributing to cytokine induction following influenza A
virus infection.We used dual-luciferase and influenza ribonu-
cleoprotein(RNP)assays to demonstrate the critical involvement
of TLR10in cytokine production induced by influenza A viruses.
This study provides previously unidentified evidence suggesting
a role of TLR10in virus infection.
Results
TLR10Is Expressed in Human Macrophages and Its Expression Is Enhanced by Influenza Virus Infection.Among the10known human TLRs,TLR3,-7,and-8,together with retinoic acid-
inducible gene1(RIG-I)are known to recognize influenza virus
infection(17,18).In this study,we have confirmed the basal
expression levels of TLR10mRNA in primary human monocyte-
derived macrophages and a human monocytic cell line(THP-1)
(Fig.1A).TLR10protein expression was also determined using
flow cytometry(Fig.1B).As previous data had demonstrated
that TLR10was expressed in cells of the B-cell lineage,Raji B
cells were used as positive control for TLR10staining(19).THP-
1cells expressed abundant TLR10protein,at a level comparable
to Raji B cells.TLR10was predominantly expressed intracellu-
larly,with very little or no detection on the surface of the intact
cells(Fig.1B).
The expression level of TLRs1–10and RIG-I after influenza A
infection of primary human macrophages was investigated(Fig.
1C).Compared with mock-infected cells,the relative fold ex-
pression of TLR10mRNA increased markedly following influenza
A H1N1(～20-fold increase)or H5N1(>40-fold increase)infec-
tion.These findings were confirmed by the marked increase
in number of TLR10cDNA copies following H1N1or H5N1infection(Fig.S1A).Similarly,influenza A infection markedly increased TLR10mRNA expression in THP-1cells(Fig.1D). Thus,both cell types were used for subsequent experiments in this study.
Next,the kinetics of TLR10expression induced by influenza A virus was measured over a time course of influenza infection in macrophages.Expression of TLR10was markedly up-regulated by H5N1virus infection at a multiplicity of infection(MOI)of2 at6h postinfection(Fig.2A).Expression of TLR10was further increased at12h after H5N1virus infection.Infection by H5N1 virus at lower MOI(MOI=0.001)led to strong induction of TLR10at48h postinfection with a further increase at72h postinfection(Fig.2B).Human H1N1virus induced a similar
TLR10expression pattern but to a lesser intensity compared with H5N1virus(Fig.2A and B).Induction of TLR10expression was also detected in human alveolar epithelial cells(A549cells) in response to influenza A virus infection(Fig.S1B).TLR10 protein expression following influenza A virus infection was demonstrated using immunofluorescence staining.Mock-infected human macrophages only showed very little or no immuno-staining for TLR10.Increased TLR10protein expression was observed in H5N1-and H1N1-infected cells,with H5N1virus inducing more protein expression compared with H1N1virus (Fig.2C).Specificity of TLR10antibody was confirmed using Western blotting on wild-type and TLR10-overexpressed THP-1 cells(Fig.S2).
The difference between two viruses on TLR10induction is much more pronounced following low MOI infection(Fig.2B) and its expression was shown to have a correlation with virus replication and production,especially at the low MOI(Fig.S3B). In single cycle infection experiments(MOI=2),although the two viruses had comparable viral replication(Fig.S3A),H5N1 virus remained a more potent inducer of TLR10.
Mechanism of TLR10Induction by Influenza A Virus Infection. Induction of TLR10is dependent on virus replication.To determine if the induction of TLR10in infected cells is dependent on
virus Fig.1.Expression of TLR10in primary human mac-rophages and THP-1cells.(A)Basal mRNA expression of TLR10in primary human macrophages(MФ)and THP-1cells determined by RT-PCR.(B)Determination of TLR10protein by flow cytometry in intact or per-meabilized human Raji and THP-1cell lines.Cells were stained with either FITC-conjugated isotype control antibody(open histogram)or FITC-conjugated anti-human TLR10antibody(gray tinted histogram).Data shown are the ratio value of a signal-to-isotype con-trol based on the median of FITC fluorescence intensity.Changes in expression level of TLR10in response to infection by H1N1and H5N1influenza A viruses with MOI of2at6h after infection com-pared with mock infection in(C)primary human macrophages and(D)THP-1cells.Results shown are representative of biological replicates performed in three independent experiments and error bars in-dicate SD of technical triplicates.
replication,identical doses of infectious or UV-inactivated in-fluenza virus were added to human macrophages.UV-inactivated influenza virus did not induce TLR10expression compared with live virus infection at 6h after infection,suggesting that the expression of TLR10is dependent on virus replication (Fig.3A ).
Induction of TLR10mRNA is dependent on de novo protein synthesis.To determine if TLR10expression is induced directly by virus transcription or via the autocrine/paracrine feedback effects from other mediators or by viral protein synthesis,the protein synthesis inhibitor,cycloheximide (CHX)was used to treat the cells before and after virus infection (Fig.3B ).Induction of TLR10by both influenza A viruses at 6h after infection was markedly suppressed in the presence of 10or 30μM CHX (Fig.3B ),suggesting that de novo protein synthesis is required for the induction of TLR10mRNA.The CHX doses used did not induce cytopathic effect or alter the expression of the housekeeping gene β-actin.
Soluble factors secreted by influenza A virus-infected human macrophages induce TLR10expression.As the expression of TLR10required viral
replication and de novo protein synthesis,we investigated whether soluble mediators (e.g.,cytokines or other intermediates)released from influenza A virus-infected human macrophages could induce TLR10expression in uninfected cells.We thus developed an in vitro cell model to investigate the effect of these soluble mediators on TLR10expression.Culture supernatants of human macro-phages infected with influenza A virus were collected at 6h after infection,filtered through a 100-kDa pore filter (Millipore)to remove any infectious virus,and added to uninfected human macrophages.Real-time RT-PCR data showed that TLR10ex-pression was up-regulated by more than fourfold in uninfected cells stimulated with supernatants of H5N1-infected cells com-pared with mock-infected cells.Similarly,supernatants from H1N1-infected cells also induced TLR10expression in uninfected cells,
but to a lower extent (2.4-fold)(Fig.3C ).Because TNF-αis one of the cytokines that are up-regulated in human macrophages and secreted to culture supernatant in response to influenza A virus infection (13),we next investigated the effect of TNF-αon TLR10expression.Different concentrations of TNF-α(5×101and 5×103pg/mL)were chosen to mimic the secretory level of this cytokine in response to H1N1and H5N1infections,respec-tively (13).Expression of TLR10was up-regulated in the pres-ence of TNF-αin a dose-dependent manner (Fig.3D ),suggesting that TNF-αis one possible mediator for TLR10induction in human macrophages after influenza virus infection.
Cytokine induction by influenza A virus is mediated via TLR10.We next investigated whether the expression of cytokines typically up-regulated following influenza A virus infection (Fig.4A )(14,15)is TLR10dependent.TLR10shRNA knockdown (KD)in THP-1cells (Fig.4B )significantly reduced the expression of TLR10mRNA by ～60%compared with control cells.H1N1virus-induced IL-8and IL-6mRNA expression was significantly suppressed by 73%and 52%,respectively,in TLR10shRNA knockdown cells compared with control cells at 6h after in-fection (Fig.4C and D ).TLR10knockdown also significantly suppressed IFN-βand IL-29mRNA induction in virus-infected cells by 71%and 65%,respectively (Fig.4E and F ).TNF-αmRNA expression was not affected by TLR10knockdown (Fig.4G ).Secretory IL-8protein was measured using ELISA,and in agreement with the mRNA data,H1N1virus-induced IL-8protein was markedly suppressed in TLR10knockdown cells compared with control (Fig.4H ).
Similar to the H1N1virus,H5N1virus-induced proinflam-matory cytokine and IFN expression was also markedly sup-pressed in TLR10knockdown cells generated using the siRNA silencing approach (Fig.S4).In conclusion,the data here in-dicated that expression of proinflammatory cytokines as well
as
Fig.2.Kinetics of influenza A virus-induced TLR10expression in human macrophages.Expression of TLR10in human macrophages infected by H1N1or H5N1influenza A viruses at (A )MOI of 2or (B )0.001compared with mock infection at different postinfection time were assessed by RT-PCR.The result of one representative experiment from three independent experiments with three donors is shown.Error bars indicate SD of three technical triplicates.(C )TLR10protein expression (FITC-green)was detected using immunofluo-rescent staining.Cells were counterstained with DAPI (blue)and viewed in a fluorescent microscope (magnification 400×).Multinucleate giant cells are seen,especially in H5N1virus infected
cells.
Fig.3.Mechanism of TLR10induction by influenza A virus infection.(A )TLR10expression in cells infected by UV-irradiated H1N1(uvH1N1)and H5N1(uvH5N1)influenza A viruses at MOI of 2were compared with nonirradiated virus infection at 6h postinfection.(B )Suppression of TLR10expression in H1N1and H5N1virus infected cells (MOI of 2)by treatment with protein synthesis inhibitor,cycloheximide (CHX).(C )Induction of TLR10expression in uninfected human macrophages after challenged with H1N1supernatant (H1S)and H5N1supernatant (H5S)compared with mock supernatant (MS)at 3h after stimulation.(D )Induction of TLR10by TNF-αin a dose-dependent manner.Data shown are representative of biological replicates performed in three independent experiments and error bars indicate SD of technical triplicates.
I M M U N O L O G Y
type I and type III IFNs induced by influenza A virus infection was,at least partially,mediated via TLR10.
We investigated the effect of TLR10knockdown on virus replication.Influenza virus titer was comparable in TLR10knock-down cells compared with control (Fig.S5).
As influenza A virus-induced IL-8was found to be the most suppressed cytokine observed in the TLR10gene silencing experiments (Fig.4and Fig.S4),we then performed a virus RNP reconstitution assay to further determine whether the induction of IL-8is TLR10dependent.Viral RNP complex genes (PB2,PB1,PA,and NP)of influenza A virus were transfected into 293T cells to mimic viral replication.The plasmid pPOLI-NS-Luc that expresses vRNA-like luciferase RNA was used to monitor the activity of viral polymerases.If the RNP is func-tional,the vRNA produced from the pPOLI-NS-Luc plasmid will be transcribed by the viral polymerases leading to the synthesis of the luciferase protein used as a reporter (20).Human TLR10expression plasmid was also cotransfected into 293T cells to examine the effect of its expression on viral replication as reflected in the luciferase activity.At 20h posttransfection,the luciferase activity had increased 25-fold and 20-fold in RNP-transfected and RNP/TLR10-transfected cells,respectively (Fig.5A ).This increased luciferase activity confirmed that the RNP reconstitution assay is functional in both RNP-transfected and RNP/TLR10-transfected cells and that TLR10expression has no influence on the polymerase activity of H5N1virus.During the course of influenza virus infection,RNP and RNP-generated products are some of the PAMPs recognized by cellular sensors leading ultimately to the production of cytokines,including IL-8(21).Therefore,we next determined the IL-8mRNA expression in the same setting.IL-8expression has only increased 5-fold in RNP-transfected cells,whereas its expression was increased 65-fold in RNP/TLR10-transfected cells at 20h posttransfection (Fig.5B ).The data suggest that TLR10substantially enhanced vRNP-induced activation of IL-8expression.These results are in agreement with the effect of TLR10gene silencing data,indi-cating that TLR10can contribute to IL-8induction during viral replication.
Discussion
Since its initial identification in 2001(22),little is known about the role of TLR10.In the present study,we demonstrated a previously unidentified role of TLR10in innate immune responses elicited by influenza virus infection.
Basal expression of TLR10was detectable in human primary macrophages and the related cell line THP-1.Our present data show the induction of this receptor by H5N1virus infection,and to a lesser extent by human H1N1virus,suggesting TLR10may have a role related to virus host defense and pathogenicity.The
difference between H5N1and H1N1viruses in TLR10induction is far more pronounced following low MOI infection,which is likely to be more akin to the conditions pertaining to natural infection in vivo.
We investigated the mechanism of TLR10induction after in-fluenza virus infection.Our findings suggested that induction of TLR10requires virus replication and is dependent on de novo protein synthesis following infection.Culture supernatants of virus-infected human macrophages modestly up-regulated TLR10expression in uninfected cells in a paracrine manner (Fig.3C ),as did TNF-α(Fig.3D ),but such up-regulation was markedly less than that observed with replicating virus (Fig.3A ).The relative roles of virus replication,secretory mediators (e.g.,TNF-α)in supernatants and synergy between these in TLR10induction needs further investigation.
Although the function of TLR10was previously unknown,we now identify its involvement in cytokine expression in influenza virus-infected cells.TLR10contributes to the induction of both antiviral IFNs such as type I and type III IFNs as well as pro-inflammatory cytokines such as IL-8and IL-6.Cytokine dysre-gulation has been proposed to be one of the mechanisms con-tributing to the pathogenesis of H5N1disease (13–15,23).The significantly higher level of TLR10induction following
H5N1
Fig.4.Cytokines induced by influenza A virus are regulated via TLR10.(A )Induction of proinflammatory cytokines and IFNs in H1N1virus infected THP-1cells.(B )The knockdown efficiencies of TLR10shRNA knock-down (TLR10KD)in THP-1cells assessed by RT-PCR.Relative expression of virus induced proinflammatory cytokine genes,(C )IL-8and (D )IL-6and type I and III IFNs,(E )IFN-βand (F )IL-29in TLR10shRNA knockdown cells compared with control at 6h after H1N1virus in-fection.(G )TNF-αgene expression was not affected by TLR10knockdown.(H )Secretory IL-8protein level in culture supernatant collected from TLR10knockdown and control cells after virus infection determined using ELISA.Basal IL-8protein level in culture supernatant before infection was included for comparison.Data shown are average of two independent experiments and error bars indicate SD of six measurements obtained from the two independent experiments.(*P <
0.05).
Fig.5.Expression of proinflammatory cytokine IL-8was mediated via TLR10during influenza A virus replication.(A )Dual-luciferase assay:293T cells were transfected with pPOLI-NS-Luc reporter and pRL-CMV control plasmid,together with the plasmids including the expression plasmids of PB2,PB1,PA and NP (RNP)and human TLR10expression plasmid (TLR10).Cells were harvested at 20h after transfection.Luciferase activity shown was the Firefly luciferase activity normalized to Renilla luciferase activity.(B )RT-PCR analysis of proinflammatory cytokines IL-8mRNA expression.Similar to A ,293T cells were harvested at 20h after transfection.Data shown are representative of two independent experiments and error bars indicate SD of technical triplicates.
infection compared with H1N1infection also raises the possi-bility that TLR10may play a role in immunopathology and virus pathogenesis by amplifying proinflammatory cytokine cascades. Our previous data has also demonstrated a role of RIG-I and to a lesser extent,TLR3,in regulating influenza A virus-induced cytokines(24).These pathways may act in synergy as RIG-I, TLR3,and TLR10are all up-regulated upon H5N1infection. The cross-talk and balance of different PRR signaling pathways in response to virus infection will thus be an interesting area for future study.
TLR10was first cloned in2001(22),yet little is known about this receptor.It remains the only member of the human TLR family without a defined agonist,signaling pathway,or function. Recent studies have suggested that TLR10may be responsible for sensing of bacterial lipopeptides(12,25).Here we report that TLR10acts as an innate immune sensing receptor for influenza virus infection.Importantly,both TLR10and viral RNP complex were required for the activation of the expression of the proin-flammatory cytokine gene IL-8.Because viral RNP can be sensed by RIG-I to induce IFN(21),it will be of great interest to determine whether and how TLR10might affect IFN induction. The involvement of RIG-I in IL-8induction by TLR10and viral RNP also merits further investigation.Nevertheless,our findings suggest that viral RNP might act through TLR10to activate cy-tokine production.In other words,component(s)of the viral RNP complex or its products could be a ligand for TLR10to trigger signaling for downstream cytokine expression.Further studies are needed to define which viral component is recognized by TLR10, i.e.,viral protein,viral RNA,or the whole RNP complex. Genetic polymorphisms of this receptor have been recently reported to be related to a number of diseases,including in-flammatory disease such as Crohn’s disease(7)and respiratory disease such as asthma(8)making the study of TLR10an ex-tremely important area to explore in general and in relation to the respiratory tract.
In this investigation of the role of TLR10in influenza virus infection,we used primary human peripheral blood monocyte-derived macrophages as one cell type for our experimental studies.It is noted that alveolar macrophages and epithelial cells are likely to be the first targets of an invading pathogen and the role of TLR10in these cells need to be investigated in more detail in future.However,previous studies have shown that, compared with human alveolar macrophages,primary human peripheral blood monocyte-derived macrophages are more per-missive to,and are more active in expressing cytokines in re-sponse to influenza virus infection in vitro(26).Thus,peripheral blood monocyte-derived macrophages remain relevant to path-ogenesis because blood monocytes are quickly recruited and differentiated into macrophages in the infected lung.They are likely to be involved in amplification of cytokine cascades,which may be relevant to protection as well as to immune pathology. The absence of functional TLR10in mice implies that the role of this receptor cannot be investigated in conventional experi-mental mouse infection studies of influenza(or other viruses) using mice.The work reported here provides important data that point to a role for TLR10in influenza virus infection and open a new field of study.It is likely that TLR10plays a role in sensing and responding to a range of virus infections other than influenza. Materials and Methods
Viruses.H5N1clade1virus A/Vietnam/3212/04and the human seasonal in-fluenza H1N1virus A/HK/54/98were passaged in Madin-Darby canine kidney (MDCK)cells and titrated in these cells by tissue culture infectious dose50 (TCID50)assays.
Cells.Human peripheral blood monocytes were separated from buffy coats obtained from healthy blood donors provided by the Hong Kong Red Cross Blood Transfusion Service.The mononuclear cells were separated by density gradient centrifugation(Ficoll-Paque;Pharmacia Biotech)and purified by adherence(14).All protocols using human donor cells were approved by the
ethics committee of the University of Hong Kong.The cells were allowed
to differentiate for14d in vitro in RPMI-1640(Life Technologies)with5%
(vol/vol)autologous human serum before virus infection experiments.Human monocytic cell line THP-1,alveolar epithelial cell line A549,and the human
kidney epithelial cell line293T were obtained from ATCC.Cells were cul-
tured and maintained according to manufacturer instructions.Phorbol-12-myristate-13-acetate activation of THP-1cells was not used,as we wished
to examine the impact of influenza virus infection on nonactivated cells.
Virus Infection.Cells were infected with influenza A viruses(or UV-inactivated viruses)at MOI of2or0.001,as indicated.After30min of virus adsorption,the
virus inoculum was removed,the cells were washed with warm culture medium,and incubated in macrophage serum-free medium,RPMI-1640or DMEM(Life Technologies)supplemented with0.6mg/L penicillin and60mg/L streptomycin.
Drug Treatment.Cells were pretreated with protein synthesis inhibitor(CHX) (Invitrogen)for45min before infection.Cells were treated with TNF-αfor3h
before cell lysate collection.The respective drugs were maintained in the culture medium throughout the experiments.
shRNA-Mediated Gene Silencing.TLR10knockdown THP-1cell lines were constructed by stable expression of shRNA designed to knockdown TLR10
gene expression.Five different MISSION shRNA plasmids(Sigma-Aldrich) containing hairpin TLR10shRNA sequence were used for generating TLR10 knockdown cells.Each of the plasmids was cotransfected with ViraPower lentiviral packaging mix(Life Technologies)into293T cells to produce TLR10 shRNA lentiviral particles.THP-1cells were infected with the lentiviral par-
ticles followed by antibiotic selection in culture medium containing20μg/mL puromycin(Sigma-Aldrich),resulting in five THP-1cell lines with different shRNA sequences inserted into the genome.Knockdown efficiency of the
TLR10gene expression was determined by RT-PCR using mRNA extracted
from parental and puromycin-selected THP-1cells.The two cell lines that showed the highest knockdown efficiency were used to confirm the speci-
ficity of gene silencing of TLR10in independent experiments.
Construction of TLR10-Overexpressed THP-1Cells.TLR10gene sequence was
cloned into pLenti6.2/V5DEST vector(Life Technologies)for the construction
of a TLR10overexpression cell line.Lentiviral particles that incorporated
TLR10RNA were produced as described above using pLenti6.2/TLR10.THP-1
cells were infected with the TLR10lentivirus and selection was carried out
using culture medium containing10μg/mL blasticidin(Life Technologies).
mRNA was extracted from the blasticidin-resistance cells and overexpression
of TLR10was confirmed using RT-PCR.
Small Interfering RNA(siRNA)-Mediated Gene Silencing.Accell siRNAs against human TLR10and control siRNAs were transiently transfected into THP-1
cells using siRNA delivery medium according to the manufacturer’s protocol (Accell;Thermo Fisher Scientific).Three days after transfection,the cells
were infected with influenza A viruses and cell lysates collected as indicated.
Three individual and pooled siRNAs targeting TLR10were used to confirm
the specificity of gene silencing of TLR10in independent experiments.
RT-PCR.Total RNA from influenza virus-infected cells and viral RNA from culture supernatants of virus-infected cells were isolated using RNeasy Mini
kit(Qiagen)and QIAamp Viral RNA Mini kit(Qiagen),respectively.cDNA was synthesized from RNA using poly(dT)primers or uni-12primers(5′-AGCAA-AAGCAGG-3′)and SuperScript III reverse transcriptase(Invitrogen).The PCR primers used in this study are shown in Table S1.Transcript expression was monitored using a SYBR Fast qPCR master mix kit(Kapa Biosystems)with specific primers.The fluorescence signals were measured in real time with
a7500Fast Real-Time PCR System(Applied Biosystems).The specificity of the
SYBR Green PCR signal was confirmed by melting curve analysis.The threshold
cycle(CT)was defined as the fractional cycle number at which the fluorescence reached10times the SD of the baseline(from cycles2–10).The ratio change in
target gene relative to theβ-actin control gene was determined by the2-ΔΔCT1 method,as described previously(14).
Immunofluorescence Staining.Cells were seeded on coverslips and infected
with influenza virus at MOI of2for18h.For immunofluorescence staining,
the cells were fixed with4%(vol/vol)paraformaldehyde for10min and then permeabilized with0.2%Triton X-100in PBS for30min at room temperature
I
M
M
U
N
O
L
O
G
Y
(RT).After washing with PBS,cells were incubated with10%(vol/vol) normal blocking serum in PBS for20min,followed by incubation with primary anti-human mouse TLR10antibody(Imgenex)for1.5h at RT. After washing,the cells were incubated with FITC-conjugated anti-mouse IgG(Imgenex).Cell nuclei were counterstained with4′6-diamidino-2-phenylindole(Sigma-Aldrich).
Western Blotting.Western blotting was performed using the whole cell lysate. Equivalent amounts of protein from cell lysates were heat denatured in sample buffer[62.5mM Tris·HCl,30%(vol/vol)glycerol,2%(wt/vol)SDS,5% (vol/vol)2-mercaptoethanol,0.01%bromophenol blue]and separated by electrophoresis on6%(wt/vol)SDS/PAGE and then transferred to poly-vinylidene difluoride membranes.The membrane was blocked in PBS-0.1% Tween20containing5%(vol/vol)skim milk for1.5h and immunoblotted with TLR10antibody(Imgenex).A Full-Range Rainbow molecular weight marker(GE Healthcare)was used to determine the size of TLR10.Bound antibody was detected by incubation with HRP-conjugated IgG antibody(GE Healthcare)and ECL Plus solution(GE Healthcare).
Flow Cytometry.Cells were washed in PBS and incubated with an optimal concentration of Fixable Viability Dye eFluor780(eBioscience)before fixation with2%(vol/vol)paraformaldehyde.Nonspecific binding was reduced by incubation with3%(vol/vol)FBS,3%(vol/vol)normal human serum,3% (vol/vol)normal mouse serum,1mM EDTA,0.1%sodium azide in PBS (blocking buffer)for10min at room temperature,in the presence(i.e., permeabilized cells)or absence(i.e.,intact cells)of0.5%saponin.Samples were then placed on ice for additional20-min incubation.Finally,cells were incubated for45min on ice with5μg/mL of anti-human mouse TLR10-FITC antibody or isotype control diluted in blocking buffer,with or without saponin. Cells were then washed and data were collected from≥30,000viable cells on a LSRII flow cytometer(BD biosciences)and postacquisition analyses were performed with FlowJo software(TreeStar).
ELISA.Cytokine proteins in culture supernatants were quantified by ELISA (R&D Systems)according to the manufacturer’s protocol.The detection limits for IL-8detection using the ELISA kit is7.5–2,000pg/mL.
Virus-Free Supernatant Stimulation Assay.To investigate the paracrine effects of virus-infected macrophages on TLR10expression,the supernatant of influenza H5N1-infected(H5S),H1N1-infected(H1S),and mock-infected (MS)macrophages(at MOI of2)were collected6h after infection.Super-natants were filtered using a100-kDa pore filter(Millipore)to remove any virus and added to fresh(uninfected)macrophages.The macrophages were harvested at3h post supernatant challenge and RNA was extracted with RNeasy Mini kits(Qiagen)to study TLR10expression.The expression of in-fluenza M gene in uninfected cells was measured to ensure that no virus was present in culture supernatants.
RNP Reconstitution Assay.Expression vectors of PB2,PB1,PA,and NP genes and pPOLI-NS-Luc reporter genes were provided by K.P.Mok(University of Hong Kong,Hong Kong,China).Briefly,the PB2,PB1,PA,and NP cDNAs of a highly pathogenic H5N1virus,A/Vietnam/1203/04,were synthesized by reverse transcription of viral RNA and subcloned into the pHW2000vector as described(27).In the RNP assay,pPOLI-NS-Luc was the reporter plasmid used for the determination of the viral polymerase activity(20).Expression of vRNA-like negative-sense luciferase RNA was driven by the polymerase I promoter.Sense luciferase RNA was synthesized/replicated by viral RNPs and the activity of viral polymerases was quantitated by the luciferase ac-tivity.For the RNP assay,293T cells were transfected with pPOLI-NS-Luc(100 ng),the control plasmid:pRL-CMV(10ng;Promega),the expression plasmids of PB2,PB1,PA,and NP genes(100ng each)and/or TLR10expression plas-mid using TransIT-Express Reagent(Mirus Bio).Dual luciferase assay was performed according to the manufacturer’s instruction(Promega).Expres-sion of proinflammatory cytokine gene IL-8was determined using real-time PCR.
Statistical Analysis.Student t test was used for data analysis in this study and results were considered as statistically significant when P values were<0.05.
ACKNOWLEDGMENTS.We thank Li Ping-Hung for his technical support and Dr.Mok Ka-Pun for providing the viral gene expression vectors.This work was supported by a grant from the Research Grant Council of Hong Kong Special Administrative Region(HKU-776110M),research fundings from the National Institute of Allergy and Infectious Diseases(Contract HHSN266200700005C),and Area of Excellence Scheme of the University Grants Committee(AoE/M-12/96).
1.Kawai T,Akira S(2011)Toll-like receptors and their crosstalk with other innate re-
ceptors in infection and immunity.Immunity34(5):637–650.
2.Medzhitov R(2007)Recognition of microorganisms and activation of the immune
response.Nature449(7164):819–826.
3.Diebold SS,Kaisho T,Hemmi H,Akira S,Reis e Sousa C(2004)Innate antiviral re-
sponses by means of TLR7-mediated recognition of single-stranded RNA.Science 303(5663):1529–1531.
4.Lund JM,et al.(2004)Recognition of single-stranded RNA viruses by Toll-like receptor
7.Proc Natl Acad Sci USA101(15):5598–5603.
5.Kawai T,Akira S(2010)The role of pattern-recognition receptors in innate immunity:
Update on Toll-like receptors.Nat Immunol11(5):373–384.
6.Hasan U,et al.(2005)Human TLR10is a functional receptor,expressed by B cells and
plasmacytoid dendritic cells,which activates gene transcription through MyD88.
J Immunol174(5):2942–2950.
7.Morgan AR,Lam WJ,Han DY,Fraser AG,Ferguson LR(2012)Genetic variation within
TLR10is associated with Crohn’s disease in a New Zealand population.Hum Immunol 73(4):416–420.
https://www.wendangku.net/doc/3614898553.html,zarus R,et al.(2004)TOLL-like receptor10genetic variation is associated with
asthma in two independent samples.Am J Respir Crit Care Med170(6):594–600.
9.Guirado M,et al.(2012)Association between C13ORF31,NOD2,RIPK2and TLR10
polymorphisms and urothelial bladder cancer.Hum Immunol73(6):668–672.
10.Zhou XX,et al.(2006)Sequence variants in toll-like receptor10are associated with
nasopharyngeal carcinoma risk.Cancer Epidemiol Biomarkers Prev15(5):862–866. 11.Kim D,et al.(2010)Reactive oxygen species enhance TLR10expression in the human
monocytic cell line THP-1.Int J Mol Sci11(10):3769–3782.
12.Guan Y,et al.(2010)Human TLRs10and1share common mechanisms of innate
immune sensing but not signaling.J Immunol184(9):5094–5103.
13.Cheung CY,et al.(2002)Induction of proinflammatory cytokines in human macro-
phages by influenza A(H5N1)viruses:A mechanism for the unusual severity of hu-man disease?Lancet360(9348):1831–1837.
14.Lee SMY,et al.(2008)Hyperinduction of cyclooxygenase-2-mediated proinflamma-
tory cascade:A mechanism for the pathogenesis of avian influenza H5N1infection.
J Infect Dis198(4):525–535.15.Lee SMY,et al.(2009)Systems-level comparison of host-responses elicited by avian
H5N1and seasonal H1N1influenza viruses in primary human macrophages.PLoS ONE 4(12):e8072.
16.Lee SMY,Yen HL(2012)Targeting the host or the virus:Current and novel concepts
for antiviral approaches against influenza virus infection.Antiviral Res96(3):391–404.
17.Koyama S,et al.(2007)Differential role of TLR-and RLR-signaling in the immune
responses to influenza A virus infection and vaccination.J Immunol179(7):4711–4720.
18.Le Goffic R,et al.(2007)Cutting edge:Influenza A virus activates TLR3-dependent
inflammatory and RIG-I-dependent antiviral responses in human lung epithelial cells.
J Immunol178(6):3368–3372.
19.Hornung V,et al.(2002)Quantitative expression of toll-like receptor1-10mRNA in
cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides.J Immunol168(9):4531–4537.
20.Li OT,et al.(2009)Full factorial analysis of mammalian and avian influenza poly-
merase subunits suggests a role of an efficient polymerase for virus adaptation.PLoS ONE4(5):e5658.
21.Rehwinkel J,et al.(2010)RIG-I detects viral genomic RNA during negative-strand RNA
virus infection.Cell140(3):397–408.
22.Chuang T,Ulevitch RJ(2001)Identification of hTLR10:A novel human Toll-like re-
ceptor preferentially expressed in immune cells.Biochim Biophys Acta1518(1-2): 157–161.
23.de Jong MD,et al.(2006)Fatal outcome of human influenza A(H5N1)is associated
with high viral load and hypercytokinemia.Nat Med12(10):1203–1207.
24.Hui KP,et al.(2011)H5N1influenza virus-induced mediators upregulate RIG-I in
uninfected cells by paracrine effects contributing to amplified cytokine cascades.
J Infect Dis204(12):1866–1878.
25.Mikacenic C,Reiner AP,Holden TD,Nickerson DA,Wurfel MM(2013)Variation in the
TLR10/TLR1/TLR6locus is the major genetic determinant of interindividual difference in TLR1/2-mediated responses.Genes Immun14(1):52–57.
26.Yu WC,et al.(2011)Viral replication and innate host responses in primary human
alveolar epithelial cells and alveolar macrophages infected with influenza H5N1and H1N1viruses.J Virol85(14):6844–6855.
27.Mok KP,et al.(2009)Viral genetic determinants of H5N1influenza viruses that
contribute to cytokine dysregulation.J Infect Dis200(7):1104–1112.
Lee et al.10.1073/pnas.1324266111
Fig.S1.Influenza A virus-induced TLR10expression.(A)The absolute number of TLR10cDNA copies in primary human macrophages infected by influenza A virus of hemagglutinin(H)and neuraminidase(N)subtypes,H1N1or H5N1(MOI of2),at6h after infection determined using RT-PCR.Uninfected(mock)cells were included for comparison.Expression of TLR10was normalized toβ-actin expression.Data shown are representative of biological replicates performed in at least three independent experiments and error bars indicate SD of technical triplicates.(B)Expression of TLR10in alveolar epithelial cells(A549)infected by H1N1or H5N1influenza A viruses at(B)MOI of2or(C)MOI of0.001compared with mock infection at different postinfection time assessed by RT-PCR.Data
shown are representative of two independent experiments and error bars indicate SD of technical triplicates.
Fig.S2.Western blot analysis of TLR10.Confirmation of specificity of TLR10antibody using WT and TLR10-overexpressed(OE)THP-1cell lysate.
Fig.S3.Kinetics of influenza viral replication in human macrophages.Cells were infected with H1N1and H5N1virus at (A )MOI of 2or (B )MOI of 0.001.Culture supernatants were collected at the indicated time,and the viral M gene of the progeny viruses were determined using RT-PCR.Data shown are representative of biological replicates performed in two experiments.
Fig.S4.Cytokines induced by H5N1virus regulate via TLR10.(A)The knockdown efficiencies of TLR10siRNAs(TLR10KD)in human monocytic cells assessed by RT-PCR.Expression of H5N1induced(B)IL-8,(C)IL-6,(D)IFN-β,and(E)IL-29in TLR10siRNA knockdown cells compared with control at6h after infection.Data
shown are representative of three independent experiments and error bars indicate SD of technical triplicates.(*P<0.05).
Fig.S5.Progeny virus production in TLR10shRNA knockdown THP-1cells.TLR10shRNA knockdown(TLR10KD)and control cells were infected with H1N1 virus at MOI of2.The culture supernatants were collected at the indicated time,and the viral titers were determined using TCID50assay.Results shown are
average of two independent measurements and error bars indicate SD of duplicate measurements.
Table S1.Primers used for real-time PCR
Gene Forward(5′–3′)Reverse(5′–3′)
TLR1TCCACGTTCCTAAAGACCTATCC GGTTCACAGTAGGGTGGCAA TLR2ATCCTCCAATCAGGCTTCTCT ACACCTCTGTAGGTCACTGTTG TLR3TTGCCTTGTATCTACTTTTGGGG TCAACACTGTTATGTTTGTGGGT TLR4TACAAAATCCCCGACAACCTCC GCTGCCTAAATGCCTCAGGG TLR5GCCGGTCCTGTGTTTGGAAT AGGTTGGGCAGGTTTCTGAAG TLR6CATGTTCCAAAAGACCTACCGC ACTCACAATAGGATGGCAGGATA TLR7TGTTTCCAATGTGGACACTGAA TGTTCGTGGGAATACCTCCAG TLR8ATGTTCCTTCAGTCGTCAATGC TTGCTGCACTCTGCAATAACT TLR9CTGCCACATGACCATCGAG TGTAGCTCAGGTTTAGCTCTTCC TLR10CTCCCAACTTTGTCCAGAAT TGGTGGGAATGCAATAGAAT RIG-I CCTACCTACATCCTGAGCTACAT TCTAGGGCATCCAAAAAGCCA
IL-8ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC
IL-6AAATTCGGTACATCCTCGACGG GGAAGGTTCAGGTTGTTTTCTGC IFN-βATGACCAACAAGTGTCTCCTCC GCTCATGGAAAGAGCTGTAGTG IL-29CACATTGGCAGGTTCAAATCTCT CCAGCGGACTCCTTTTTGG TNF-αATGAGCACTGAAAGCATGATCC GAGGGCTGATTAGAGAGAGGTC
β-Actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT