英文 LAMP检测大马哈鱼胰腺组织坏死
https://www.wendangku.net/doc/973834268.html,/Investigation
Journal of Veterinary Diagnostic
https://www.wendangku.net/doc/973834268.html,/content/23/4/704The online version of this article can be found at:
DOI: 10.1177/1040638711407897
2011 23: 704J VET Diagn Invest Rungkarn Suebsing, Myung-Joo Oh and Jeong-Ho Kim
)
Oncorhynchus keta in chum salmon (Infectious pancreatic necrosis virus detecting Evaluation of rapid and sensitive reverse transcription loop-mediated isothermal amplification method for
Published by:
https://www.wendangku.net/doc/973834268.html, On behalf of:
Official Publication of the American Association of Veterinary Laboratory Diagnosticians, Inc. can be found at:
Journal of Veterinary Diagnostic Investigation Additional services and information for
https://www.wendangku.net/doc/973834268.html,/cgi/alerts Email Alerts:
https://www.wendangku.net/doc/973834268.html,/subscriptions Subscriptions: https://www.wendangku.net/doc/973834268.html,/journalsReprints.nav Reprints:
https://www.wendangku.net/doc/973834268.html,/journalsPermissions.nav Permissions:
What is This?
- Jul 6, 2011
Version of Record >>
Journal of Veterinary Diagnostic Investigation 23(4) 704 –709
? 2011 The Author(s)Reprints and permission:
https://www.wendangku.net/doc/973834268.html,/journalsPermissions.nav DOI: 10.1177/1040638711407897
https://www.wendangku.net/doc/973834268.html,
Introduction
Infectious pancreatic necrosis (IPN) is a highly infectious viral disease of salmonids considered as one of the most seri-ous limiting factors for salmonid aquaculture.18 The disease has a wide geographical distribution, occurring in most of the salmonid farming countries of North and South America, Europe, and Asia.3,11,18 Clinical signs include darkening of the body, mild swelling on the head, abdominal distension, and a spiral swimming motion.18 Infect ious pancreat ic necrosis virus (IPNV) can cause higher than 90% mortality in rainbow trout (Oncorhynchus mykiss ) fry depending on several factors such as virus strain, host age, and stocking density. Significant mortalities due to IPNV infection also occur in the post-smolt stage of Atlantic salmon (Salmo salar ) after sea transfer.1,8,18,20 Asymptomatic survivors can act as carriers of viable IPNV for life and can shed infective viral particles, which can be transmitted to their offsprings.20
Classification of IPNV strains has been traditionally per-formed by serological techniques. Most IPNV strains belong to serogroup A, which includes 9 serotypes, serotypes A1 (reference strain, West Buxton [WB]), A2 (Spajarup [Sp]), A3 (Abild [Ab]), A4 (Hecht [He]), A5 (Tellina [Te]), A6 (Canada 1 [C1]), A7 (Canada 2 [C2]), A8 (Canada 3 [C3]), and A9 (Jasper [Ja]),18 whereas only a few IPNV strains
comprise serogroup B (B1, type strain TV-1).6 Recent phylo-genetic analysis of IPNV based on the sequencing analysis of the VP2 gene 2,10 revealed that 6 genogroups (I–VI) including 10 genotypes (I.1, I.2, II, III.1, III.2, IV .1, IV .2, V .1, V .2, VI) exist.2 Most IPNV isolates from Europe are identified as Sp (genogroup V) and Ab (genogroup II) strains, whereas most of the isolates from salmonids in Asia and North America are classified as Ja (genotype I.1) and VR-299 (genotype I.2) strains.2,7,10,11 In Korea, IPNV has been isolated from chum salmon (Oncorhynchus ke t a ), rainbow trout, goldfish (Carassius auratus ), and Korean rockfish (Sebastes schlegelii ), all of which are known to belong to VR-299.5,9,11
The reverse transcription polymerase chain reaction (RT-PCR) assay has been widely used for detection and identi-fication of salmonid birnaviruses.13,23,24 However, it requires a second amplification step that is more prone to con-tamination, and it is also time consuming. A novel method,
407897
XXXXXX10.1177/1040638711407897Sueb
sing et al.IPNV detected in chum salmon by RT-LAMP assay
From the Faculty of Marine Bioscience & Technology, Gangneung-Wonju National University, Gangneung, Korea (Suebsing, Kim), and the Department of Aqualife Medicine, Chonnam National University, Yeosu, Korea (Oh).
1
Corresponding Author: Jeong-Ho Kim, Faculty of Marine Bioscience & Technology, Gangneung-Wonju National University, Gangneung 210-702, Korea. jhkim70@gwnu.ac.kr
Evaluation of rapid and sensitive reverse transcription loop-mediated isothermal amplification method for detecting Infectious pancreatic necrosis virus in chum salmon (Oncorhynchus keta )
Rungkarn Suebsing, Myung-Joo Oh, Jeong-Ho Kim 1
Abstract. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed for detecting Infectious pancreatic necrosis virus (IPNV) in chum salmon (Oncorhynchus keta ) in Korea. The RT-LAMP is a novel approach of nucleic acid gene amplification with high specificity, sensitivity, and rapidity under isothermal conditions. Based on the VP2/NS gene sequence of VR-299 and Jasper strains, a set of 6 IPNV-specific primers was designed to recognize 8 diverse sequences of the IPNV RNA. The assay was successfully optimized to detect IPNV at 65°C in 30 min. The detection limit was 0.075 tissue culture infectious dose infecting 50% of inoculated cultures per milliliter (TCID 50/ml) from IPNV-infected rainbow trout gonad (RTG)-2 cells, whereas nested reverse transcription polymerase chain reaction (nRT-PCR) had a sensitivity of 7.5 TCID 50/ml. Using RT-LAMP assay, field samples were analyzed and the results compared with those of nRT-PCR assay. Two hundred and sixty-six out of 659 (40.4%) samples were IPNV-positive by RT-LAMP , whereas 182 of 659 samples (27.6%) were IPNV-positive by nRT-PCR. The results indicate that RT-LAMP can be a useful tool for early field diagnosis of IPNV .
Key words: Chum salmon; Infectious pancreatic necrosis virus ; Oncorhynchus keta ; reverse transcription loop-mediated isothermal amplification.
IPNV detected in chum salmon by RT-LAMP assay705
loop-mediated isothermal amplification (LAMP) assay, was recently introduced for improving the diagnosis of several aquatic animal diseases.19 First developed in the year 2000, the LAMP can amplify nucleotides from a few copies to 109 copies under isothermal conditions within 1 hr.16 The prin-ciple of LAMP is based on autocycling strand displacement DNA synthesis by the Bst DNA polymerase large fragment, which has high strand displacement activity, with 2 specially designed inner and 2 outer primers.16 The LAMP is highly specific because the target sequence can be detected by 6 independent sequences in the initial stage followed by 4 independent sequences in the later stages of the LAMP reaction. As such assay is held under isothermal condition, it can be easily completed in a water bath or a heating block; thus, an expensive thermal cycler is not necessary.
The LAMP assay is also applicable for detecting RNA by using a reverse transcription (RT) together with DNA poly-merase.16 The RT-LAMP assay was developed to detect many fish pathogens,19 which include Infectious hematopoietic necrosis virus (IHNV),4,14Infectious salmon anemia virus (ISA V),14 Viral hemorrhagic sept icemia virus (VHSV),21 and Spring viraemia of carp virus (SVCV).12 The sensitivity of RT-LAMP assay was greater than that of the RT-PCR assay in these studies. The RT-LAMP has been previously used for detect-ing IPNV,22 and the primers used were designed on the basis of the NS/VP3 encoding region of the Sp and Ab strains, which are the most common strains in Europe.22 In the cur-rent study, the RT-LAMP was developed for detecting IPNV based on sequences of major strains in Asia-Pacific regions (VR-299 and Ja strains). Moreover, the detection limits of IPNV between the RT-LAMP and nRT-PCR assays were compared, and its applicability to field samples was assessed.
Materials and methods
Viruses
Infectious pancreatic necrosis virus (Ja, VR-299, Sp, and Ab strains) and VHSV were propagated in rainbow trout gonad (RTG)-2 cells. Infectious hematopoietic necrosis virus was propagated in Chinook salmon embryo (CHSE)-214 cells. Virus-infected cells were grown in minimum essential medium (MEM)a supplemented with 10% fetal bovine serum (FBS),b 200 mM L-glutamine, 50 IU/ml of penicillin, and 50 mg/ml of streptomycin, and maintained at 15°C. Then, the viruses were titrated in 96-well plates, and the tissue culture infectious dose infecting 50% of inoculated cultures per mil-liliter (TCID
50
/ml) was calculated.17
RNA extraction
Wild adult chum salmon (1–4 kg body weight) and fry (0.5–0.9 g body weight) with no clinical signs of disease were collected and used for testing. One hundred milligrams of fresh kidney and spleen were homogenized in 750 μl of total RNA isolation reagent c and incubated at room tempera-ture for 5 min. Then, 200 μl of chloroform was added to the homogenates and mixed by vortex. The suspension was incu-bated at room temperature for 10 min and centrifuged at 12,000 × g for 10 min. The upper solution was transferred into a new 1.5-ml microcentrifuge tube and precipitated by adding 200 μl of 100% isopropanol on ice for 10 min, then centrifuged at 12,000 × g for 10 min. The RNA pellet was washed with 70% (v/v) ethanol, centrifuged at 9,000 × g for 5 min, and then dried at 95°C in the incubator for 2 min or until the ethanol was evaporated. To elute RNA, diethylpyro-carbonate (DEPC)-treated water d was added to make a final concentration of 100 ng/μl and kept at –80°C. The RNA quan-tification was measured by spectrophotometer.e
Genomic viral RNA was extracted from 500 μl of IPNV-infected cell culture supernatant as described above and used for optimizing the RT-LAMP conditions. After elution of the RNA in DEPC-treated water, it was stored at –80°C until required.
Primers for the RT-LAMP assay
Reverse transcription loop-mediated isothermal amplifica-tion primers for IPNV were designed according to consensus sequences of the IPNV VP2/NS gene (VR-299 and Ja strains; G enBank accession nos. AF342729 and M18049) using LAMP primer designing software.f The VP2/NS junc-tion region was selected because it is known as a conserved region of aquatic birnaviruses, and because the VR299 and Ja strains are the most common strain of IPNV in Asia-Pacific regions. The forward inner primer (FIP) consisted of the complementary sequence of F1c (22 nucleotide [nt]), a TTTT spacer, and the sense sequence of F2 (18 nt). The back-ward inner primer (BIP) contained a sense sequence of B1c (20 nt), a TTTT spacer, and the complementary sequence of B2 (18 nt). The outer primers consisted of the F3 (20 nt) and complementary sequence of B3 (18 nt). Loop primers were designed in order to increase the LAMP sensitivity and con-tained a loop forward primer (LF; 19 nt) and loop backward primer (LB; 19 nt). The details of the primers are listed in Table 1.
Conditions of the RT-LAMP reaction
The RT-LAMP was carried out in 25 μl of total reaction mix-ture containing 2 μM each FIP and BIP, 0.2 μM each F3 and B3, 2 μM each LF and LB primers, 1× thermopol-supplied reaction buffer, 0.8 M betaine,a 8 mM magnesium sulfate,a 1 mM each deoxynucleotide triphosphate mix,g 6 U of Bst DNA polymerase,h and 0.25 U of Avian myeloblastosis virus reverse transcriptase.i Uninfected RTG-2 cells were included as negative control. The reaction temperature and time were optimized at 65°C for 30 min to make specific and rapid amplification of IPNV. The RT-LAMP products were analyzed by 2% gel electrophoresis.
706 Suebsing et al.
Nested RT-PCR assay for Infectious pancreatic necrosis virus detection
The RT -PCR assay was conducted by adding P-1 and P-2 prim-ers 23 (Table 2) and 100 ng/μl of total RNA into the lyophi-lized RT-PCR premix tube,d to a reaction volume of 20 μl with DEPC-treated water. Reverse transcription amplifica-tion was conducted under the initial step at 42°C for 45 min, then 94°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 48°C for 30 sec, and 72°C for 30 sec. A final extension step was conducted at 72°C for 5 min. The expected PCR product was 359 base pairs (bp). A nested PCR amplification was carried out by mixing 5 μl of RT-PCR products with 10 μM of each P-3 and P-4 primers 23 (Table 2) in the PCR pre-mix tube,d then water was added up to a final volume of 20 μl. The expected size of PCR product was 168 bp. The fol-lowing amplification conditions were used an initial dena-turation step at 94°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 48°C for 30 sec, 72°C for 35 sec, and a final extension step was conducted at 72°C for 5 min.
Sensitivity and specificity of RT-LAMP and sensitivity of the nested RT-PCR
To determine the sensitivity of the RT-LAMP and nRT-PCR assays, 10-fold serial dilutions (7.5 × 104 TCID 50/ml to 7.5 × 10-3 TCID 50/ml) of RNA extracted from IPNV (Ja strain)-infected RTG-2 cells were tested with the optimized condi-tions for the RT-LAMP and the nRT-PCR as described above. The specificity of the RT-LAMP assay was tested using total RNA extracted from IPNV strains (VR299, Ab, and Sp),
VHSV-infected RTG-2 cells, and IHNV-infected CHSE-214 cells, respectively.
Evaluation of the RT-LAMP assay with field samples
Comparing the field sample detection results of the RT-LAMP with those of the nRT-PCR allowed researchers to assess the feasibility of the RT-LAMP assay to detect IPNV. The fry and adult chum salmon were collected from the Namdae River basin and hatcheries at Yangyang City on the east coast of Korea during 2006–2010 for routine monitoring of IPNV . The kidney and spleen from individual adult fish and pooled 5 whole fry were used for RNA extraction as men-tioned above. Then, RT-LAMP and nRT-PCR assays were conducted with the conditions above and the results were compared.
Sequencing and sequence alignment
The LAMP products were purified by gel purification kit d according to the manufacture’s protocol. Products were then digested using MspA1I enzyme h at 37°C for 16 hr. The MspA1I enzyme-digested fragment of 177 bp was produced as pre-dicted from the amplicon structure. After repurification, 100 ng of the digested products were cloned into a vector.i Plasmid DNA was subsequently purified using a commer-cial kit j according to the manufacturer’s protocol. A 50 ng/μl of purified plasmid DNA was then directly sequenced k by using M13 universal primer set. The sequences of IPNV VP2/NS junction region were aligned with the sequences
Table 1. Oligonucleotide primers developed for detecting Infectious pancreatic necrosis virus by reverse transcription loop-mediated isothermal amplification assay.*Primer Position
Sequence (5’–3’)
F31348–1367AGAGGCATCAGAAAAGTGGC B31531–1548
ATAGCTTCCTGCCTCGGA
FIP 1432–1453/TTTT/1374–1391TGGTCTTGGTGAGGTCCCCAATTTTTCGTGCTGTCAACGCTCTT BIP 1465–1484/TTTT/1507–1524GGACGCTACCTGTCACACGCTTTTGGCCCATGAGTCCATGAC LF 1438–1459CTATAAGGGGAGCCGCCAT LB
1508–1539
CGGAGGCCGCTACCATGAT
*F3 = outer primer consisting of 20 nucleotide (nt); B3 = outer primer of complementary sequence consisting of 18 nt; FIP = forward inner primer; BIP = backward inner primer; LF = loop forward primer of 19 nt; LB = loop backward primer of 19 nt.
Table 2. Oligonucleotide primers used for detecting Infectious pancreatic necrosis virus by nested reverse transcription polymerase chain reaction assay.Primer Primer orientation
Position Sequence (5’–3’)
P-1Forward 1403–1425AGAGATCACTGACTTCACAAGTGAC P-2Reverse 1738–1761TGTGCACCACAGGAAAGATGACTC P-3Forward 74–90CAACACTCTTCCCCATG P-4
Reverse
225–241
AGAACCTCCCAGTGTCT
IPNV detected in chum salmon by RT-LAMP assay 707
available in the GenBank database (National Center for Biotechnology Information) according to the ClustalW software.25
Results
Sensitivity of RT-LAMP and nested RT-PCR and specificity of RT-LAMP detection
The sensitivity of RT-LAMP was 100-times higher than the nRT-PCR. The RT-LAMP was able to detect the template at 0.075 TCID 50/ml (Fig. 1, lane 7), whereas the nRT-PCR detected the template at 7.5 TCID 50/ml (Fig. 2, lane 5). The cross amplification of RNA of each salmonid virus (i.e., IPNV-Ja, 7.5 × 108 TCID 50/ml; VR299, 7.6 × 108 TCID 50/ml; Ab, 7.4 × 108 TCID 50/ml; Sp, 7.2 × 108 TCID 50/ml) strains–infected RTG -2 cells, VHSV-infected RTG -2 cells (7.7 × 108 TCID 50/ml), and IHNV-infected CHSE-214 cells (7.5 × 108 TCID 50/ml) with the RT-LAMP primers was also used for confirming the specificity of the RT-LAMP assay. All
IPNV isolates were positive, but none of the other salmonid fish viruses was positive with the primers, indicating that the RT-LAMP assay is specific to IPNV (Fig. 1, lanes 9–13).
Evaluation of the RT-LAMP method with field samples
The prevalence of IPNV in chum salmon is summarized in Table 3. The occurrence of IPNV in chum salmon was 266 out of 659 (40.4%) by the RT-LAMP . In contrast, the nRT-PCR results revealed the prevalence was 182 out of 659 (27.6%). All nRT-PCR–positive samples were RT-LAMP positive in each group and each year.
Sequence alignment
Ten different RT-LAMP products of IPNV were sequenced and aligned with published sequences of the VR-299 (acces-sion no. AB343572), Ja (accession no. M18049), Ab (acces-sion no. AF342729), and Sp (accession no. L13988) strains available in the GenBank database. All the sequences had a high degree of homology with the VR-299 and Ja strains (Fig. 3). In particular, LAMP products of 5 samples (062, 072, 073, 082, and 091) were completely homologous with the VR-299 and Ja strains; only 4 nucleotides differences (out of 177) were observed in LAMP products of 5 sam-ples (061, 071, 081, 083, and 092).
Discussion
The loop-mediated isothermal amplification is a novel diag-nostic tool to detect aquatic pathogens.19
In the current study,
Figure 1. The sensitivity and specificity of reverse
transcription loop-mediated isothermal amplification assay for detection of Infectious pancreatic necrosis virus (IPNV). Lane M: 100-bp DNA marker; lanes 1–8: 10-fold dilutions of RNA extracted from IPNV (Jasper strain)-infected rainbow trout gonad (RTG)-2 cells (7.5 × 104 TCID 50/ml to 7.5 × 10-3 TCID 50/ml); lane 9: IPNV (Abild strain)-infected RTG-2 cells; lane 10: IPNV (VR-299 strain)-infected RTG-2 cells; lane 11: IPNV (Spajarup strain)-infected RTG-2 cells; lane 12: Viral hemorrhagic septicemia virus (VHSV)-infected RTG-2 cells; lane 13: IHNV-infected Chinook
salmon embryo (CHSE-214) cells; N = negative control.
Figure 2. The sensitivity of nested reverse transcription polymerase chain reaction for detection of Infectious pancreatic necrosis virus (IPNV). Lane M: 100-bp DNA marker; lanes 1–8: 10-fold dilutions of RNA extracted from IPNV (Jasper strain)-infected rainbow trout gonad (RTG-2) cells (7.5 × 104 TCID 50/ml to 7.5 × 10-3 TCID 50/ml); N = negative control.
Table 3. Comparison of the prevalence of Infectious pancreatic necrosis virus in chum salmon (Oncorhynchus keta ) by nested reverse transcription polymerase chain reaction (nRT-PCR) and reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays.*
Method
Percent positive Year Fish No. of samples
nRT-PCR RT-LAMP 2006Adult 80ND ND 2007Fry 32 3 (9.4) 7 (21.9) Adult 80ND 13 (16.3)2008Fry 32ND 11 (34.4) Adult 80 9 (11.3) 52 (65.0)2009Fry 49 47 (95.9) 47 (95.9) Adult 120110 (91.7)115 (95.8)2010Fry 66ND 4 (6.1) Adult
120 13 (10.8) 17 (14.2)Total
659
182 (27.6)
266 (40.4)
*ND = Not detected. Numbers in parentheses are percentages.
708 Suebsing et al.
the RT-LAMP reaction could be completed in 30 min, at 65°C, indicating the high amplification effectiveness of the LAMP assay.
The developed IPNV-specific RT-LAMP could detect not only Asian-Pacific strains, but also European strains (Sp and Ab strains) with the primers in the current study. In Korea, there is no report on the European strains at the present time. Therefore, the IPNV-specific primers developed in the cur-rent study can be useful for detecting the European IPNV strains (Sp and Ab) and helpful for preventing the potential introduction of those strains. But, it is still unclear if the RT-LAMP primers in the present study can detect other IPNV genogroups because they were not tested. In addition, the IPNV-specific RT-LAMP primers could not detect other salmonid viruses such as IHNV and VHSV . The increased sensitivity of the RT-LAMP compared to the nRT-PCR in the current study was because it used 6 primers recognizing 8 distinct regions on the target RNA of IPNV .15,16
The RT-LAMP generated products were sequenced to confirm the amplification of a correct target sequence by this assay. Sequences alignment showed that the RT-LAMP products have the genetic similarity with the VR-299 (98–100%) and Ja strains (98–100%). Because the RT-LAMP product sequences were too short for the comparison, the VR-299
and Ja strains could not be distinguished in the current study.
The increased sensitivity of RT-LAMP assay for detecting IPNV with field samples over the nRT-PCR assay indicates that the RT-LAMP assay developed in the current study is suitable for early field diagnosis. Moreover, the RT-LAMP assay developed is rapid, sensitive, cost-effective, and spe-cific for detecting IPNV . Such assay needs only a water bath or a heating black for isothermal amplification and the result can be achieved within 1 h including gel electrophoresis, while nRT-PCR needs 4 hr to be completed. Considering the importance of salmonids aquaculture and frequent domestic translocation of the eggs and the fry in Korea, the RT-LAMP assay can be a suitable test for routine early field diagnosis and quarantine programs to prevent spread of infection.
Acknowledgements
The authors thank K. B. Seong and C. H. Lee (Cold Water Fish Research Center, Yangyang, Korea) for their help in collecting fish samples.
Sources and manufacturers
a. Sigma-Aldrich, St. Louis, MO.
b. Lonza, Walkersville, MD.
Figure 3. Sequence alignment of 10 different the Infectious pancreatic necrosis virus reverse transcription loop-mediated isothermal amplification assay products with the reference strains. Reference strains: VR299: AB343572, Jasper: M18049, Abild: AF342729, and Spajarup: L13988. A dot in each sequence represents a nucleotide identical to that of the VR299 strain.
IPNV detected in chum salmon by RT-LAMP assay709
c. TRI reagent, Molecular Research Center, Cincinnati, OH.
d. Bioneer, Daejeon, Korea.
e. NanoDrop 1000, Thermo Scientific, Wilmington, DE.
f. PrimerExplorer V4, Eiken Chemical, Tokyo, Japan.
g. Solgent, Seoul, Korea.
h. New England Biolabs, Ipswich, MA.
i. pGEM-T, Promega Corp., Madison, WI.
j. Qiagen GmBH, Hilden, Germany.
k. 3730xl Genetic Analyzer, Applied Biosystems, Foster City, CA.
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The current work was supported by a grant from the National Research Foundation of Korea (2009-0087136).
References
1. Bebak-Williams J, McAllister PE, Boston R: 2002, Effect
of fish density and number of infectious fish on the survival of rainbow trout, Oncorhynchus mykiss (Walbaum), dur-ing epidemics of infectious pancreatic necrosis. J Fish Dis 25:715–726.
2. Cutrin JM, Barja JL, Nicholson BL,et al.: 2004, Restriction
fragment length polymorphisms and sequence analysis: an approach for genotyping infectious pancreatic necrosis virus reference strains and other aquabirnaviruses isolated from Northwestern Spain. Appl Environ Microbiol 70:1059–1067. 3. Gregory A, Munro L, Wallace IS, Raynard RS: 2007, Detection
of Infectious pancreatic necrosis virus (IPNV) from the environ-ment in the vicinity of IPNV-infected Atlantic salmon farms in Scotland. J Fish Dis 30:621–630.
4. Gunimaladevi I, Kono T, LaPatra SE, Sakai M: 2005, A loop
mediated isothermal amplification (LAMP) method for detec-tion of Infectious hematopoietic necrosis virus (IHNV) in rain-bow trout (Oncorhynchus mykiss). Arch Virol 150:899–909. 5. Hah YC, Hong SW, Kim MH,et al.: 1984, Isolation of Infec-
tious pancreatic necrosis virus from goldfish (Carassius auratus) and chum salmon (Oncorhynchus keta) in Korea. Kor J Microbiol 22:85–90.
6. Hill BJ, Way K: 1995, Serological classification of Infectious
pancreatic necrosis (IPN) virus and other aquatic birnaviruses.
Ann Rev Fish Dis 5:55–77.
7. Hosono N, Suzuki S, Kusuda R: 1994, Evidence for relatedness
of Japanese isolates of birnaviruses from marine fish to IPNV.
J Fish Dis 17:433–437.
8. Jarp J, Greve AG, Olsen AB,et al.: 1994, Risk factors of furuncu-
losis, infectious pancreatic necrosis and mortality in post-smolts of Atlantic salmon, Salmo salar L. J Fish Dis 18:67–78.
9. Joh SJ, Shon CI, Kang SW, et al.: 2008, Molecular characteriza-
tion and genogrouping of VP1 of aquatic birnavirus GC1 isolated from rockfish Sebastes schlegeli in Korea. J V et Sci 9:85–90.10. Jung SJ, Kim SR, Joung IY,et al.: 2008, Distribution of marine
birnavirus in cultured olive flounder Paralichthys olivaceus in Korea. J Microbiol 46:265–272.
11. Lee JH, Heo GJ, Lee CH: 1996, Isolation and identification of
Infectious pancreatic necrosis virus from rainbow trout cultured in Korea. J Microbiol 34:124–130.
12. Liu Z, Teng Y, Xie X,et al.: 2008, Development and evalua-
tion of a one-step loop-mediated isothermal amplification for detection of Spring viremia of carp virus. J Applied Microbiol 105:1220–1226.
13. Lopez-Jimena B, Garcia-Rosado E, Infante C,et al.: 2010, Detec-
tion of Infectious pancreatic necrosis virus (IPNV) from asymp-tomatic red banded seabream, Pagrus auriga V alenciennes, and common seabream, Pagrus pagrus (L.), using a non-destructive procedure. J Fish Dis 33:311–319.
14. McCarthy EL, Egeler TJ, Bickerstaff LE,et al.: 2006, Detec-
tion and identification of IHN and ISA viruses by isothermal DNA amplification in microcapillary tubes. Anal Bioanal Chem 386:1975–1984.
15. Nagamine K, Hase T, Notomi T: 2002, Accelerated reaction
by loop-mediated isothermal amplification using loop primers.
Mol Cell Probes 16:223–229.
16. Notomi T, Okayama H, Masubuchi H,et al.: 2000, Loop-
mediated isothermal amplification of DNA. Nucleic Acids Res 28:e63.
17. Reed LJ, Muench H: 1938, A simple method of estimating fifty
per cent end-points. Am J Hyg 27:493–497.
18. Reno PW: 1998, Infectious pancreatic necrosis and associated
aquatic birnaviruses. In: Fish diseases and disorders, ed. Woo PTK, Bruno DW, pp. 1–55. CABI Publishing, New York, NY.
19. Savan R, Kono T, Itami T, Sakai M: 2005, Loop-mediated
isothermal amplification: an emerging technology for detection of fish and shellfish pathogens. J Fish Dis 28:573–581.
20. Smail DA, Bruno DW, Dear G,et al.: 1992, Infectious pancre-
atic necrosis (IPN) virus Sp serotype in farmed Atlantic salmon, Salmo salar L., post-smolts associated with mortality and clini-cal disease. J Fish Dis 15:77–83.
21. Soliman H, El-Matbouli M: 2006, Reverse transcriptase
loop-mediated isothermal amplification (RT-LAMP) for rapid detection of Viral hemorrhagic septicaemia virus (VHS). V et Microbiol 114:205–213.
22. Soliman H, Midtlyng PJ, El-Matbouli M: 2009, Sensitive
and rapid detection of Infectious pancreatic necrosis virus by reverse transcription loop mediated isothermal amplification.
J Virol Methods 158:77–83.
23. Suzuki S, Hosono N, Kusuda R: 1997, Detection of aquatic
birnavirus gene from marine fish using a combination of reverse transcription- and nested PCR. J Mar Biotechnol 5:205–209. 24. Taksdal T, Dannevig BH, Rimstad E: 2001, Detection of Infec-
tious pancreatic necrosis (IPN)-virus in experimentally infected Atlantic salmon parr by RT-PCR and cell culture isolation. Bull Eur Assoc Fish Pathol 21:214–219.
25. Tamura K, Dudley J, Nei M, Kumar S: 2007, MEGA4: Molec-
ular Evolutionary Genetics Analysis (MEGA) software version
4.0. Mol Biol Evol 24:1596–1599.
Journal of Veterinary Diagnostic Investigation 24(4) 813
? 2012 The Author(s)Reprints and permission:
https://www.wendangku.net/doc/973834268.html,/journalsPermissions.nav DOI: 10.1177/1040638712450578https://www.wendangku.net/doc/973834268.html,
Erratum
450578
JVDXXX10.1177/1040638712450578
Corrigendum
Stegelmeier, BL, et al.: 2010, Experimental rayless goldenrod (Isocoma pluriflora ) toxicosis in goats. J Vet Diagn Invest. 22: 570–577
In the article “Experimental rayless goldenrod (Isocoma pluriflora ) toxicosis in goats” by Bryan L. Stegelmeier et al., the published mean body weight and the means and statistics of serum biochemistries were carried out on groups of 4 animals, not 3, as described in the Material and Methods section. The additional animal in each group was part of an auxiliary physi-ologic study and though the animals were dosed and treated the same, they were not necropsied and were not included in the histologic study. To correct this oversight, the corrected weight and chemistry table (shaded cells indicate corrected numbers) are listed below. The differences are minimal and do not alter the conclusions. In addition, reference 7 has been deleted.
Material and Methods: “Fifteen, yearling, female Spanish goats weighing 29.4 ± 3.4 kg (mean ± standard deviation) were randomly divided into 5 groups with 3 animals per group.”
References: Reference 7 should be deleted
Corrected Table 1. Selected mean serum biochemical data from groups of 3 goats dosed with rayless goldenrod (Isocoma pluriflora ) to obtain benzofuran ketone doses of 0, 10, 20, 40, and 60 mg/kg body weight for 7 days.*
Serum result (mean ± standard deviation)
Creatinine kinase (< 350 U/l)0226 ± 93107 ± 673 ± 16a 66 ± 30a 10226 ± 160118 ± 8206 ± 184a 495 ± 623ab 20967 ± 1233306 ± 276240 ± 113a 497 ± 277ab 40125 ± 18117 ± 246,699 ± 5,329b 16,270 ± 11,054b
60202 ± 93202 ± 1242,987 ± 3,701a 10,433 ± 4,326ab Cardiac troponin-I (<0.40 U/l?)0<0.02 ± 0.0<0.02 ± 0.0<0.02 ± 0.0<0.02 ± 0.0 10<0.02 ± 0.0<0.02 ± 0.0<0.02 ± 0.0<0.02 ± 0.0 20<0.02 ± 0.00.17 ± 0.260.05 ± 0.03<0.02 ± 0.0 40<0.02 ± 0.0<0.02 ± 0.0 1.98 ± 3.39 1.79 ± 2.97
60<0.02 ± 0.0<0.02 ± 0.0 1.38 ± 2.310.13 ± 0.18Aspartate aminotransferase (<125 U/l)096 ± 791 ± 683 ± 2a 72 ± 3a 10147 ± 69104 ± 1189 ± 8a
97 ± 13a 20164 ± 82284 ± 248293 ± 252ab 376 ± 256a 40112 ± 17102 ± 12991 ± 184c 3,277 ± 1,556b
6096 ± 13115 ± 31819 ± 571bc 2,095 ± 1,333b
Alanine aminotransferase (<55 U/l)039 ± 337 ± 338 ± 0a 43 ± 18a 1044 ± 142 ± 339 ± 2a 37 ± 1a 2041 ± 957 ± 3463 ± 38ab 61 ± 25a 4046 ± 244 ± 4134 ± 24a 333 ± 127b
6040 ± 744 ± 5118 ± 84ab 267 ± 176b Lactate dehydrogenase (<1,560 U/l)01,061 ± 1451,075 ± 62875 ± 213a 573 ± 115a 101,334 ± 6681,050 ± 223942 ± 265a 709 ± 182a 201,650 ± 1,5462,617 ± 2,6851,185 ± 449a 753 ± 447a 401,054 ± 2011,162 ± 1305,996 ± 2,491b 9,891 ± 3,210b
60
1,026 ± 287
1,277 ± 348
3,623 ± 2,924ab
7,011 ± 5,205a
*Different means (<0.05) between groups are indicated with superscript letters.
?Estimates of normal range were determined as 2 standard deviations from mean values of control goats and pretreatment samples. These ranges are probably laboratory and assay specific.
?Cardiac troponin-I concentrations below detection limits are reported as <0.02 ng/ml.