gmr799
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)
Molecular marker-assisted selection of the ae alleles in maize
F. Chen, S.W. Zhu, Y. Xiang, H.Y. Jiang and B.J. Cheng Life Science College, Anhui Agricultural University, China Corresponding author: B.J. Cheng E-mail: beijiucheng@https://www.wendangku.net/doc/9b18883634.html, Genet. Mol. Res. 9 (2): 1074-1084 (2010)Received February 21, 2010Accepted March 19, 2010Published June 11, 2010DOI 10.4238/vol9-2gmr799
ABSTRACT. The ae (amylose extender) recessive mutant alleles in maize are an important genetic resource for the development of high-amylose cultivars. On the basis of ae allele sequences (from the National Center for Biotechnology Information), the ae mutant alleles were cloned from high-amylose maize and the allelic Ae gene from common maize luyuan92 inbred lines. Five pairs of primers were designed to screen for a molecular marker of ae alleles, yielding a dominant molecular marker, ae 474. We used 53 types of high-amylose maize and common maize inbred lines and their hybrid and backcross offspring for verification and analysis. The ae dominant molecular marker was effective in selecting for the ae alleles and for biological materials with a high-amylose genotype. Presence and absence of the marker in the offspring conformed to the expected Mendelian ratios. Using this marker, we were able to detect the ae alleles in a backcross and its second generation more efficiently (53.3 and 73.3%, respectively) than was possible without marker selection. These data indicate that the marker can be used as a tool to improve selection efficiency and accelerate the cultivation of new varieties of high-amylose maize.Key words: Maize; Starch branching enzyme; High amylase;Marker-assisted selection
1075
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)
Molecular marker-assisted selection of the ae alleles in maize INTRODUCTION
Maize grain is high in starch, amounting to 70% of the total weight of grain (Wu et al.,
2009). Common maize starch is a mixture of approximately 28% amylose and 72% amylopec-tin. There are a large number of industrial uses for amylose, including food, medicines, tex-tiles, paper, and environmental protection (Rutenberg and Solarek, 1984; Smith et al., 1997; Sun et al., 1998; Nishi et al., 2001; Seetharaman et al., 2001; Leterrier et al., 2008).
Separation of high-quality amylose from common maize is expensive, thus limiting
its industrial use and significantly influencing the cost of products. Although most high-am-ylose maize production occurs in the United States, the actual amount cultivated in the US is low (Whistler, 1958; Fergason, 1994). Because of the substantial commercial demand for amylose, the development of high-amylose maize cultivars is an important research goal. Dis-covery of the ae (amylose extender) mutant alleles was a very important step in developing high-amylose plants. Amylose content is much higher in maize endosperm possessing the ae alleles, which are single recessive endosperm mutant alleles (Fisher et al., 1996; Kim et al., 1998). Wu et al. (2009) found that the amylose content of a maize ae homozygote, possessing the modified gene, was elevated by 50-80%, relative to a cultivar without the modified gene.
The traditional method of cultivating high-amylose maize cultivars is screening by
phenotypic selection using backcross and alternate selfing, such that a backcross can be ac-quired every two generations. The method, however, is inefficient and the breeding cycle is long. The development of a stable molecular marker for the ae alleles would facilitate the identification of promising phenotypes and would accelerate the breeding of high-amylose cultivars. The goal of this study was to clone the ae and Ae alleles in maize, to analyze their sequences and to develop an ae allele molecular marker. We studied the characteristics and reliability of the ae alleles and analyzed the effect and efficiency of molecular marker-assisted selection in a high-amylose phenotype backcross.
MATERIAL AND METHODS Maize and bacterial supplies
Fifty-three test lines, including 38 inbred lines (14 high-amylose maize inbred lines with
the ae alleles and 24 common maize inbred lines), were used. Among them, high-amylose maize inbred lines, ae-1 and ae-2, were introduced from the US, and W64, B37, A619, and W23 were purchased from the market. The remaining lines were bred and maintained in the laboratory. We used 15 kinds of combination groups of high-amylose maize and common maize, derived from three initial crossings: We -4-2 x chang98, B37 x qi478, and S 4-25-2-1 x chang72. In each group, with chang98, qi478 and chang72 as recurrent parents, we were able to obtain seven groups: F 1, F 2, BC 1F 1, BC 1F 2, BC 2F 1, BC 2F 2, and BC 3F 1, each constructed in our laboratory. We used Escherichia coli DH5α, a standard strain maintained in our laboratory.
DNA extraction
We extracted genomic DNA from maize leaves using the CTAB method described by
Saghai Maroof et al. (1994). To extract genomic DNA from half seeds, the endosperms were
1076
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)
F. Chen et al.first removed and then crushed in 200 μL chloroform in a 1.5-mL tube. The crushed samples were mixed with 300 μL DNA extraction liquid (100 mM Tris-HCl, 100 mM EDTA-Na 2, 500 mM NaCl, 1.5% SDS), followed by centrifugation at 12,000 rpm for 2 min at room tempera-ture. The supernatant was transferred to a 1.5-mL tube with 500 μL cold isopropanol to pre-cipitate the DNA. To further concentrate the DNA, the solution was centrifuged at 12,000 rpm for 2 min. The resulting supernatant was discarded and the pellet dried at room temperature before being dissolved in 200 μL TE buffer. DNA quality was confirmed by electrophoresis and UV spectrophotometry. The DNA was stored at -20°C.
Determination of amylose content
Maize amylose content was measured by colorimetry (Morrison and Laignet, 1983;
Martinez and Prodolliet, 1996) and near infrared reflectance spectroscopy (Orman and Schumann Jr., 1991; Ciurczak, 1995; Campbell et al., 1997).
Cloning and sequence analysis of the ae and Ae alleles
Using the sequence of the ae alleles of maize (GenBank: AF072725), nine pairs of
sequencing primers were designed using Primer Designer. The primers were synthesized by the Shanghai Sangon Company (Shanghai, China). The ae and Ae alleles were amplified from the leaf-derived genomic DNA of high-amylose inbred lines ae-1 and common maize inbred lines luyuan92, respectively. After electrophoresis detection, recycling and connection to car-riers, we obtained full-length sequences of the two alleles, which illustrated their differences.
Screening, verification and analysis of the ae allele molecular marker selection
Based on the differences between the ae and Ae alleles, five pairs of primers were de-signed. Three high-amylose maize inbred lines (ae-1, ae-2, and S 3-4-5) and three common maize inbred lines (luyuan92, qi478, chang72) were polymerase chain reaction (PCR)-amplified to search for ae allele-specific molecular marker bands. Using the ae allele specific molecular marker primers, DNA from inbred lines and the combination groups was amplified to deter-mine the utility of the ae allele molecular marker in marker-assisted selection (MAS). Reac-tion conditions for the degenerate primer pairs were initial denaturation for 5 min at 94°C, followed by 35 cycles at 94°C for 45 s, 53°C for 45 s, an extension of 72°C for 90 s, and a final extension at 72°C for 10 min. PCR analysis was performed on a Bio-Rad PTC-100 type PCR instrument.
RESULTS
Identifying an ae alleles molecular marker
Cloning and sequence analysis
After sequencing and splicing, we obtained full-length sequences of the ae and Ae
alleles, which were analyzed for differences. The two alleles are homologous; the main differ-
1077
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)
Molecular marker-assisted selection of the ae alleles in maize ences are single nucleotide polymorphisms, a single-base insertion/deletion, and three loca-tions where the consecutive bases have been deleted (Figure 1). At bases 453-456 of this se-quence, corresponding to the region between exon 9 and exon 10, the ae allele has a four-base insertion compared to the Ae
allele.
Figure 1. Partial sequence alignment between the ae and Ae alleles.
Screening for molecular markers of the ae alleles
Five pairs of primers were used to amplify fragments (Table 1). Only primer 1 (upstream
primer: 5’-TCATCTTCTCACATTGGTCTTCC-3’, downstream primer: 5’-GCTGTGCTATG GCCATGTTTAT-3’) showed a polymorphism (Figure 2). The amplified regions of the ae and Ae alleles were at bases 6971-7467. We were unable to amplify a fragment from the common maize inbred lines, but we were able to amplify a 474-bp fragment from the high-amylose maize inbred lines. Consequently, we named this marker ae 474.
1 CCTCTTCTTAACTCGTAATGATC TGCCTCTATATTGTCTGGCTAAC
2 CTTCATAGTGTTGCTGGAAGGTC GTACTTGATCCAGGCTGGAATTG
3 TCATCTTCTCACATTGGTCTTCC GCTGTGCTATGGCCATGTTTAT
4 CACAGGCAAAGTGATGAAAC TTATACACCCCAGGCTTTC 5
TTCATGACATCTGATCACC
ATATAGAGAGGACAACGCAGC
Figure 2. Amplification of high-amylose content maize and common maize with markers. M = DNA marker (DL2000 plus). Lane 1 = luyuan92; lane 2 = ae-1; lane 3 = qi478; lane 4 = chang72; lane 5 = ae-2; lane 6 = S 3-4-5.
1078
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)
F. Chen et al.Verification of the maize ae allele molecular marker and analysis of amylose content
In 14 high-amylose maize inbred lines with the ae alleles, the specific ae 474 band was
clearly amplified (Figure 3A). However, in 24 common maize inbred lines without the ae al-leles, no band was amplified (Figure 3B). Because the ae 474 marker is stable and generates a clear band, it can be used as a dominant molecular marker linked to the ae alleles. The amylose content in 38 maize lines varied from 19.0% in cultivar 8129 to 58.2% in S 4-25-2-1, which were negative and positive, respectively, for the ae 474 marker (Table 2). All cultivars that were positive for ae 474 had substantially higher levels of amylose.
No. Cultivar
Amylose molecular
No. Cultivar
Amylose molecular
No. Cultivar
Amylose molecular
marker
marker
marker
1 ae-1 57.8 + 14 W23 53.4 + 27 qi478 22.
2 - 2 ae-2 56.5 + 15 luyuan92 24.2 - 28 dan340di 23.8 -
3 S 2-9-
4 50.2 + 16 8129 19.0 - 29 chang72 24.0 - 4 S 4-15-3-2 52.0 + 17 w-3 21.
5 - 30 dan599 21.7 - 5 S 2-9-2-1 53.4 + 18 lian87 19.8 - 31 ye478 21.1 -
6 S 3-4-6-2 49.
7 + 19 qi319 23.2 - 32 78599xuan 20.5 - 7 S 3-4-5 51.
8 + 20 zi06281 21.2 - 33 liao88 19.5 - 8 S 4-21-4 54.2 + 21 danyou 24.6 - 34 P138 24.0 -
9 S 4-25-2-1 58.2 + 22 sb-16 20.5 - 35 zheng58 21.8 -10 We -4-2 56.0 + 23 danyu133 23.1 - 36 K14 23.0 -11 W64 50.7 + 24 H178 24.9 - 37 chang98 25.2 -12 B37 53.1 + 25 shen137 20.7 - 38 chang94-2
22.7 -
13
A619
49.7 +
26
414
27.0 -
Table 2. Amylose content in 38 maize cultivars.
Nos. 1-14 are high-amylose maize cultivars of inbred lines; Nos. 15-38 are common maize cultivars of inbred lines; +: plant with ae 474 marker; -: plant without ae 474 marker.Figure 3. PCR amplification of maize inbred lines with markers. A. High-amylose content maize with markers. Lanes 1-10 = high-amylose maize; lane 11 = CK(-); M = DNA marker (DL2000 plus). B. Common maize with markers. Lanes 1-11 = common maize; lane 12
= CK(+); M = DNA marker (DL 2000 plus).
1079
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)
Molecular marker-assisted selection of the ae alleles in maize Segregation of the ae allele molecular marker in offspring
We randomly selected 90 F 1 plants, 150 BC 1F 1 plants and 150 F 2 plants from three
crosses in each generation (30, 50 and 50 plants per cross, respectively) between high-amylose and common maize cultivars. Offspring from all F 1 crosses were positive for the ae marker (Table 3). The ae 474 marker was present in the other two offspring types according to ex-pected Mendelian ratios, as shown by the chi-square analysis (P < 0.05) (Table 3, Figure 4). These data show that, using MAS, it is possible to distinguish between the AeAe genotype and the Aeae /aeae genotypes.
pos:neg ratio
F 1
We -4-2 × chang98 30 30 0 B37 × qi478
30 30 0
S 4-25-2-1 × chang72 30 30 0 F 2
We -4-2 × chang98 50 33 17 3:1
χ2 = 2.16, P < 0.05 B37 × qi478
50 32 18 3:1 χ2 = 3.22, P < 0.05
S 4-25-2-1 × chang72
50 35 15 3:1 χ2 = 0.67, P < 0.05BC 1F 1
We -4-2/chang98 × chang98 50 21 29 1:1 χ2 = 1.28, P < 0.05 B37/qi478 × qi478
50 21 29 1:1 χ2 = 1.28, P < 0.05
S 4-25-2-1/chang72 × chang72
50
19
31
1:1
χ2 = 2.88, P < 0.05
Figure 4. PCR amplification in partial BC 1F 1 and F 2 generations with ae 474 molecular markers. A. PCR amplification of a partial BC 1F 1 generation with ae 474 molecular markers. Lanes 1-12 = BC 1F 1 generation plants; M = DNA marker (DL2000 plus). B. PCR amplification in partial generation with ae 474 molecular markers. Lanes 1-13 = PCR amplification of the genome from F 2 generations; M = DNA marker (DL 2000 plus).
1080
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)F. Chen et al.Relationship between the ae allele molecular marker and amylose content
We randomly selected 100 seeds from the We -4-2 x chang98 combination for DNA ex-traction from the endosperm; an analysis was carried out for the presence of the ae 474 marker and amylose content. Maize grains with ≥32.1% amylose amplified the ae 474 band, while those with less than 29.5% did not amplify the ae 474 band (Table 4). These statistics show that, with molecular MAS, we could obtain aeae , high-amylose genotypic materials. Only aeae homo-zygous seeds have an exceptionally high amylose content. While some of the seeds with less than 21.1% amylose were ae 474-positive, those seeds are likely to have an Aeae genotype. We identified nine seeds of the F 2 generation with >38% amylose; they were all homozygous for ae .
<20.0 0 620.1-23.0 26 423.1-26.0 31 426.1-29.0 15 129.1-32.0 1 132.1-35.0 0 035.1-38.0 2 038.1-41.0 3 041.1-44.0 2 0>44.0 4 0Total
84
16
Analysis of the ae allele molecular MAS in BC 1F 1 and BC 2F 1 generations
We selected nine plants from the BC 1F 1 and BC 2F 1 generations of the We -4-2 x chang98
cross, of which five plants yielded ae 474 bands and four did not. After self-crossing, we ob-tained BC 1F 2 and BC 2F 2 generations, from each of which we chose 100 plants for ae dominant molecular marker detection (Figure 5, Table 5).
Figure 5. PCR amplification in BC 2F 2 of the BC 1F
1 generation with ae 474 markers. A. PCR amplification in BC 2F
2 of the marked BC 1F 1 generation with ae 474 markers. Lanes 1-11 = BC 1F 2 generation plant; lane 12 = CK(+); M = DNA marker (DL2000 plus). B. PCR amplification in BC 2F 2 generation of unmarked BC 1F 1 generation with ae 474 markers. Lanes 1-12 = BC 1F 2 generation plant; M = DNA marker (DL2000 plus).
1081
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)
Molecular marker-assisted selection of the ae alleles in maize
From the BC 1F 1 and BC 2F 1 plants that were positive for the marker, we detected ae 474
bands in their BC 1F 2 and BC 2F 2 offspring. For those plant sets, which demonstrated some positive ae 474 bands, the ratio of positive to negative plants was 3:1. No ae 474 bands were detected in the BC 1F 2 and BC 2F 2 offspring derived from the BC 1F 1 and BC 2F 1 plants that did not originally display the marker. These data confirm that we can obtain single plants with the ae alleles from offspring using MAS.
Selection efficiency analysis of the ae allele molecular marker in backcross offspring
Molecular MAS and non-marking random selection were respectively performed in
the BC 1F 1 and BC 2F 1 generations of the We -4-2 x chang98 cross. The frequency of molecular marker detection and the selection efficiency of the ae alleles in the backcross offspring were observed and calculated. We chose 30 plants for molecular marker detection from each BC 2F 1 and BC 3F 1 generation (Table 6).
Selective plants in BC 1F 1 generation
30 30No. of plants with marker in BC 2F 1 generation 30 14Selection efficiency (%) 100
46.7Efficiency improvement
53.3Selective plants in BC 2F 1 generation
30 30No. of plants with marker in BC 3F 1 generation 30 8Selection efficiency (%) 100 26.7Efficiency improvement
73.3
When MAS was used to identify the presence of the marker, the selection efficiency
was 100% for both BC 2F 1 and BC 3F 1, a 53.3 and 73.3% improvement, respectively, over the efficiency of non-marker selection. These results confirm that the use of MAS in a backcross can significantly improve efficiency.
plants positive negative pos:neg ratio
BC 1F 1 Negative 1 BC 1F 2
100 0 100 plants 2 100 0 100 3 100 0 100 4 100 0 100 Positive 5 100 70 30 3:1 χ2 = 1.33, P < 0.05 plants 6
100 67 33 3:1 χ2 = 3.41, P < 0.05 7 100 67 33 3:1 χ2 = 3.41, P < 0.05 8 100 69 31 3:1 χ2 = 1.92, P < 0.05 9
100 68 32 3:1 χ2 = 2.61, P < 0.05
BC 2F 1 Negative 1 BC 2F 2
100 0 100
plants 2 100 0 100 3 100 0 100 4 100 0 100
Positive 5
100 70 30 3:1 χ2 = 1.33, P < 0.05
plants 6
100 67 33 3:1 χ2 = 3.41, P < 0.05 7 100 67 33 3:1 χ2 = 3.41, P < 0.05 8 100 69 31 3:1 χ2 = 1.92, P < 0.05
9
100
68
32
3:1
χ2 = 2.61, P < 0.05
1082
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)
F. Chen et al.Rapid detection technology of the ae allele molecular marker
To establish a quick and easy PCR detection method for the ae allele molecular mark-er, seedling leaves were used for rapid extraction of DNA. By adding DNA-staining fluores-cent dyes to the tube containing DNA for PCR amplification, we could directly observe the de-velopment of PCR products under UV light. Using this method, we could accurately identify positive and negative samples at an efficiency that was comparable to that of electrophoretic analysis. It is possible, therefore, to omit the electrophoretic analysis step, which will simplify MAS procedures and improve efficiency.
DISCUSSION
Selection of the most appropriate plants with desirable characteristics is an impor-tant step in breeding new crop cultivars (Van Berloo and Stam, 2001). Individual, or direct, selection, which focuses on agronomic traits that meet breeding objectives, is a phenotypic rather than genotypic selection technique (Ribaut and Betrán, 1999; Van Berloo and Stam, 2001; Francia et al., 2005). For the target gene, molecular marker-assisted breeding technol-ogy is a rapid and accurate method, providing a very effective tool for backcross breeding (Ribaut and Betrán, 1999; Frisch and Melchinger, 2005; Collard and Mackill, 2008). Several complex factors influence MAS efficiency, such as the distance between the marker and the target gene, where the marker is not part of the target gene. In our study, the marker is part of the target gene, thus eliminating the main disadvantage of MAS; the problems of linkage and exchange are also avoided (Lande and Thompson, 1990). Because this method can be used at the seedling stage, and DNA quality required for PCR is not high, it can significantly shorten the breeding cycle and improve selection efficiency. The ae alleles are recessive mutant alleles that promote a decrease in the quantity of starch converted from sugar. The resulting maize en-dosperm is dull and the grain shows a certain degree of shrinkage. These phenotypic traits are distinctive for plants that are homozygous for ae . Its stability, however, is low and therefore using this homozygous phenotype to select the ae alleles is not efficient.
In this study, an ae allele-specific molecular marker was acquired that contained a 4-bp
nucleotide deletion, lying in an intron between exons 9 and 10 of the ae and Ae alleles, making it completely linked to the ae alleles. Although the marker is dominant, it cannot distinguish between the Aeae and aeae genotypes. The marker has high reliability and efficiency, and the PCR product can be identified visually in a micro-tube; therefore, it is simple and rapid. With the aid of this marker, high-amylose materials can be selected at a variety of life stages, from harvest to seedlings. This is particularly true when the target is the Aeae genotype in backcross breeding. The high amylose maize backcross breeding process can therefore be accelerated.
Studies have shown that the interaction(s) between ae and other starch mutant alleles
(e.g., du and su) may significantly alter amylose content (Yun and Matheson, 1993; Wang et al., 1993). Vineyard et al. (1958) reported that the level of amylose in hybrid offspring ranged from 36.5 to 64.9% in cross tests between 135 different inbred lines and a common ae donor. The substantial variability in amylose content of hybrid offspring was likely due to interactions between different “modified genes” of the germplasm and the ae alleles. The presence of the ae alleles itself, therefore, is no guarantee of exceptionally elevated amylose since the presence of other genes may cause amylose to vary from 50% to as much as 85%.
1083
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)Molecular marker-assisted selection of the ae alleles in maize The combination of ae and modified genes should be taken into consideration in the breeding process. More modified genes are needed if a consistent amylose content of 75% or more is to be achieved. Only in ae homozygous loci does the accumulation of modified genes have a selective effect.
In the process of high-amylose maize backcross breeding, the initial step is to choose
the desired ae genotype - Aeae - using the ae 474 molecular marker. Self-crossing is conducted every two or three generations, which greatly reduces costs and improves the selection ef-ficiency. Using half seed PCR and rapid amylose measurement, it is possible to screen high-amylose seeds for ae -modified genes. Using cross-breeding, we can directly select high-amy-lose seeds from the identified Aeae and aeae genotypes, to obtain aeae plants and additional modified genes.
ACKNOWLEDGMENTS
Research supported by the National High Technology Research and Development
Program (“863” Program) of China (#2006AA10Z1B4). We thank members of the Key Labo-ratory of Biomass Improvement and Conversion of Anhui province and Yan Liu for assistance in these experiments.
REFERENCES
Campbell MR, Brumm TJ and Glover DV (1997). Whole grain amylase analysis in maize using near-infrared transmittance
spectroscopy. Cereal Chem. 74: 300-303.
Ciurczak EW (1995). Use of near infrared spectroscopy in cereal products. Food Test. Anal. 5: 35-39.
Collard BC and Mackill DJ (2008). Marker-assisted selection: an approach for precision plant breeding in the twenty-first
century. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 363: 557-572.Fergason V (1994). Specialty Corns. CRC Press, Boca Raton.
Fisher DK, Gao M, Kim KN, Boyer CD, et al. (1996). Allelic analysis of the maize amylose-extender locus suggests that
independent genes encode starch-branching enzymes IIa and IIb. Plant Physiol. 110: 611-619.
Francia E, Tacconi G, Crosatti C, Barabaschi D, et al. (2005). Marker assisted selection in crop plants. Plant Cell Tissue
Organ Cult. 82: 317-342.
Frisch M and Melchinger AE (2005). Selection theory for marker-assisted backcrossing. Genetics 170: 909-917.
Kim KN, Fisher DK, Gao M and Guiltinan MJ (1998). Molecular cloning and characterization of the Amylose-Extender
gene encoding starch branching enzyme IIB in maize. Plant Mol. Biol. 38: 945-956.
Lande R and Thompson R (1990). Efficiency of marker-assisted selection in the improvement of quantitative traits.
Genetics 124: 743-756.
Leterrier M, Holappa LD, Broglie KE and Beckles DM (2008). Cloning, characterisation and comparative analysis of a
starch synthase IV gene in wheat: functional and evolutionary implications. BMC Plant Biol. 8: 98.
Martinez C and Prodolliet J (1996). Determination of amylose in cereal and non-cereal starches by a colorimetric assay:
collaborative study. Starch 48: 81-85.
Morrison WR and Laignet B (1983). An improved colorimetric procedure for determining apparent and total amylose in
cereal and other starches. J. Cereal Sci. 1: 9-20.
Nishi A, Nakamura Y, Tanaka N and Satoh H (2001). Biochemical and genetic analysis of the effects of amylose-extender
mutation in rice endosperm. Plant Physiol. 127: 459-472.
Orman BA and Schumann RA Jr (1991). Comparison of near-infrared spectroscopy calibration methods for the prediction
of protein, oil, and starch in maize grain. J. Agric. Food Chem. 39: 883-886.
Ribaut JM and Betrán J (1999). Single large-scale marker-assisted selection (SLS-MAS). Mol. Breed. 5: 531-541.Rutenberg MW and Solarek D (1984). Starch: Chemistry and Technology. 2nd edn. Academic Press, Orlando.
Saghai Maroof MA, Biyashev RM, Yang GP, Zhang Q, et al. (1994). Extraordinarily polymorphic microsatellite DNA
in barley: species diversity, chromosomal locations, and population dynamics. Proc. Natl. Acad. Sci. U. S. A. 91: 5466-5470.
1084
?FUNPEC-RP https://www.wendangku.net/doc/9b18883634.html,.br
Genetics and Molecular Research 9 (2): 1074-1084 (2010)F. Chen et al.Seetharaman K, Tziotis A, Borras F, White PJ, et al. (2001). Thermal and functional characterization of starch from
Argentinean corn. Cereal Chem. 78: 379-386.
Smith AM, Denyer K and Martin C (1997). The synthesis of the starch granule. Annu. Rev. Plant Physiol. Plant Mol. Biol.
48: 67-87.
Sun C, Sathish P, Ahlandsberg S and Jansson C (1998). The two genes encoding starch-branching enzymes IIa and IIb are
differentially expressed in barley. Plant Physiol. 118: 37-49.
Van Berloo R and Stam P (2001). Simultaneous marker-assisted selection for multiple traits in autogamous crops. Theor.
Appl. Genet. 102: 1107-1112.
Vineyard ML, Bear RP, MacMasters MM and Deatherage WL (1958). Development of “Amylosemaize” - corn hybrids
with high amylose starch. Agron. J. 50: 595-598.
Wang YJ, White P, Pollak L and Jane J (1993). Characterization of starch structures of 17 maize endosperm mutant
genotypes with Oh43 inbred line background. Cereal Chem. 70: 171-179.Whistler RL (1958). Amylose development and progress. Chemurgic Dig. 17: 38.
Wu Y, Campbell M, Yen Y, Wicks Z III, et al. (2009). Genetic analysis of high amylose content in maize (Zea mays L.)
using a triploid endosperm model. Euphytica 166: 155-164.
Yun SH and Matheson NK (1993). Structures of the amylopectins of waxy, normal, amylose-extender, and wx:ae
genotypes and of the phytoglycogen of maize. Carbohydr. Res. 243: 307-321.