当前位置：文档库 › ARMS-a sensitive detection mutation assay

ARMS-a sensitive detection mutation assay

Consultations in Molecular Diagnostics Amplification Refractory Mutation System,a Highly Sensitive and Simple Polymerase Chain Reaction Assay,for the Detection of JAK2V617F Mutation in Chronic Myeloproliferative Disorders

Qiaofang Chen,*Pin Lu,?Amy V.Jones,?Nicholas C.P.Cross,?Richard T.Silver,§and

Y.Lynn Wang*

From the Department of Pathology and Laboratory Medicine,* and the Department of Medicine,§Division of Hematology,Weill Medical College of Cornell University,New York,New York;the Immunoregulation Laboratory,?Hospital of Special Surgery,New York,New York;and the Wessex Regional Genetics Laboratory,?University of Southampton,Salisbury District Hospital,Salisbury, United Kingdom

An acquired mutation in Janus kinase2(JAK2), V617F,has recently been identified in human myelo-proliferative disorders.Detection of the mutation is helpful in differential diagnosis,prognosis,and pred-ication of therapeutic response.Because the mutation can be present in a small proportion of granulocytic populations in myeloproliferative disorder patients, a highly sensitive detection method is required.In this study,we systematically optimized the reaction conditions of a published amplification refractory mutation system-polymerase chain reaction research protocol to make it a robust clinical diagnostic test. The modifications led to a clear demonstration of the V617F mutation in a patient who would have been easily missed by the original amplification refractory mutation system-polymerase chain reaction assay. The test detects the V617F mutation not only with a high analytic sensitivity of0.05to0.1%but also with a high diagnostic specificity of99%.In addition,the assay has the ability to distinguish cases with only mutant alleles from cases with mixed normal and mutant alleles.The assay is fast and easy to perform, and no special equipment other than thermocyclers is required.All these features make the assay readily and broadly applicable in clinical molecular diagnos-tic laboratories.(J Mol Diagn2007,9:272–276;DOI: 10.2353/jmoldx.2007.060133)An acquired mutation in the JAK2gene has recently been described in human myeloproliferative disorders.1–5 JAK2is a cytoplasmic tyrosine kinase that plays an es-sential role in the signaling pathways of cytokines and growth factors.The mutation1849G?T,which leads to amino acid substitution of phenylalanine for a highly con-served valine(V617F),renders JAK2kinase constitutively active and leads to cell proliferation in the absence of the growth factors.2,4,5

The V617F mutation has been detected in65to97%of patients with polycythemia vera,23to57%of those with essential thrombocythemia(ET),and30to57%of idio-pathic myelofibrosis.1–5In the vast majority of literature, JAK2mutation is absent in normal individuals,in patients with secondary erythrocytosis and thrombocytosis,or in patients with chronic myelogenous leukemia;detection of the mutation thus aids in differential diagnosis in cases with similar clinicopathological features.6In addition, studies have found that JAK2V617F mutation is associ-ated with response to hydroxyurea in patients with ET and may be correlated with poorer survival in patients with idiopathic myelofibrosis.7,8

Several laboratory techniques have been developed for JAK2V617F genotypic analysis.Because V617F is an acquired mutation that can be present in a small propor-tion of granulocytic populations in some cases,espe-cially of ET,a highly sensitive detection method is essen-tial.7Different sensitivity of various assay methods partially accounts for the wide range of mutation frequen-cies reported in the literature.9As a matter of fact,re-evaluation of the same cases with a more sensitive tech-nique has increased the detection rate from73to97%in patients with polycythemia vera.1In addition,a highly sensitive technique is potentially useful to monitor resid-ual disease after treatment.Methodologies reported in Accepted for publication September25,2006.

Address reprint requests to Y.Lynn Wang,Department of Pathology and Laboratory Medicine,Weill Medical College of Cornell University, 1300York Ave.,New York,NY10021.E-mail:lyw2001@https://www.wendangku.net/doc/a89490187.html,.

Journal of Molecular Diagnostics,Vol.9,No.2,April2007

and the Association for Molecular Pathology

DOI:10.2353/jmoldx.2007.060133

272

the literature include direct sequencing,1,2,4,5allele-spe-cific polymerase chain reaction(PCR),1,10,11PCR-restric-tion fragment length polymorphism,5,7pyrosequenc-ing,3,12and amplification refractory mutation system (ARMS)-PCR.3The advantages and disadvantages of the methods are briefly discussed below,and interested readers are referred to a detailed review by Steensma13 for principles and potential clinical utilities of each assay.

The JAK2mutation was discovered using direct se-quencing after PCR.However,the method only detects the mutation present in more than20to30%of total DNA. Compared with sequencing,allele-specific PCR detects the mutation with a much higher sensitivity at1to?3%. However,the allele-specific PCR assay does not amplify the normal alleles,so cases that carry only mutant alleles show the same pattern as those that carry both the mu-tant and the normal alleles as a result of either heterozy-gosity or mixed clonality.With a sensitivity of?4%for mutation detection,PCR-restriction fragment length poly-morphism using restriction enzyme Bsa XI has the ability to show both mutant and normal allele in a sample.How-ever,the assay may cause misinterpretation because incomplete Bsa XI digestion would generate a mutant plus normal pattern in patients with only wild-type alleles.In addition,a restriction digestion step increases the cost, time,and labor of the test.Pyrosequencing is an emerg-ing technique based on nucleotide extension by DNA

polymerase;it is able to detect V617F in?5%of DNA, and the level of the mutant allele can be quantified. However,requirement of expensive equipment and spe-cial reagents makes it less ideal to serve as a routine clinical test.ARMS-PCR is a procedure originally devel-oped for the analysis of single nucleotide polymorphisms, and the assay has been successfully adopted to analyze the JAK2genotypes.3This technique enables simulta-neous amplification of the mutant and normal alleles plus a DNA quality control with just two pairs of primers in a single PCR tube(Figure1).The test is therefore a simple, fast,and inexpensive procedure that does not entail any special equipment other than a thermocycler.However, the method is relatively insensitive in detecting low levels of the mutation,possibly because of primer competitions among different PCR reactions.An ET case that was almost missed by the assay prompted us to optimize the reaction conditions systematically for clinical use.The modified assay detects mutation with a highly reproduc-ible analytic sensitivity of0.05to0.1%,making it suitable for the detection of low levels of JAK2mutation.The test will be potentially useful to follow minimal residual dis-ease when targeted therapies against JAK2kinase be-come available.

Materials and Methods

Cells and Patient Samples

The HEL cell line that carries homozygous mutant T al-leles was obtained from Drs.Shahin Rafii and David Jin at Weill Medical College of Cornell University and was orig-inally purchased from(American Type Culture Collection,Rockville,MD).Leukocytes from a healthy donor were purchased from the New York Blood Center(New York, NY).Eighteen DNA samples for validation were obtained from patients with myeloproliferative disorders who were referred to Salisbury District Hospital for routine analysis. Informed consents were obtained,and personal identifi-ers were removed to protect patient confidentiality for the purposes of this study.One hundred seventeen residual DNA samples from patients who were tested for other diseases were used to study the assay specificity and were obtained from the DNA bank at Weill Medical Col-lege of Cornell University in an anonymous manner. DNA Extraction

DNA from HEL cells and patient samples was extracted using the QIAamp DNA mini kit or EZ1system(Qiagen, Valencia,CA)following the manufacturer’s instruc-tions.DNA was quantified using spectrophotometric measurements.

ARMS-PCR

Principle of the ARMS-PCR assay is illustrated,and the primer sequences are shown in Figure1(modified from Jones et al3).Mismatches are included to maximize dis-crimination of the wild-type and mutant alleles.Amplifi-cations were performed using HotStart Taq polymerase (Qiagen).PCR conditions of both modified and the orig-inal method are shown in Table1,and reactions were conducted in T3000and Tgradient thermocyclers(Bi-ometra,Goettingen,Germany).PCR products were re-solved on2%agarose gels for45minutes at80

V. Intron13Exon14Intron14

Control band: 463 bp

Wild type allele band: 229 bp Mutant allele band: 279 bp

FO 5’

TCCTCAGAACGTTGATGGCAG

3’

RO 5’

ATTGCTTTCCTTTTTCACAAGAT

3’

Fwt5’ GCATTTGGTTTTAAATTATGGAGTATaTG3’

Rmt5’ GTTTTACTTACTCTCGTCTCCACAaAA3’

Figure1.Schematic diagram of the ARMS-PCR assay.Two forward and two reverse primers are used in different combinations to generate three potential PCR products.Primers FO and RO flank the exon14of the JAK2gene, resulting in a band of463bp to control for DNA quality and quantity.Primers Fwt and RO amplify a wild-type allele,generating a band of229bp,and primers FO and Rmt generate a band of279bp from the mutant allele.Primer sequences are shown below the diagram.The intended mismatches in Fwt and Rmt are shown in lowercase,and genotype-specific nucleotides are underlined.

ARMS for the Detection of JAK2Mutation273

JMD April2007,Vol.9,No.2

Pyrosequencing

Quantitation of the percentage of the V617F alleles was performed by pyrosequencing as described.14

Results and Discussion

Design of the ARMS-PCR assay is shown in Figure 1.With the original reaction conditions,a faint band of the mutant allele was barely detected in an undiluted DNA specimen from a patient with clinical and bone marrow features consistent with ET (Figure 2,top,patient 2).Given the low levels of the V617F mutation observed in ET patients,further investigation was performed using a single pair of mutant-specific primers (FO and Rmt in Figure 1).The presence of the V617F mutation was clearly demon-strated (data not shown and see below),suggesting that the analytic sensitivity of the original ARMS-PCR was suboptimal.We suspect that the low sensitivity was caused by competing PCR reactions occurring in the same reaction tube.In particular,amplification of the

control DNA fragment seemed to out-compete the reac-tions of the mutant and/or normal alleles for primers (Fig-ure 2,top;note the relative intensity of the three bands).Several changes were made to improve systematically the analytic sensitivity of the assay.The differences be-tween the original ARMS-PCR and modified version are listed in Table 1.The major changes include the follow-ing.1)The concentration of the mutant-specific primer (Rmt)was raised,and concentrations of common primers (FO and RO)were lowered to favor amplification from the mutant allele.2)The annealing temperature was lowered from 60to 58°C to favor the binding of both Fwt and Rmt primers that contain mismatches to the templates (Figure 1).The best temperature was determined to be 58°C in the temperature range of 55to 63°C tested with a gradi-ent thermocycler (data not shown).3)The number of cycles was increased from 30to 40cycles,significantly enhancing the yields of all three PCR products (data not shown).Together,these changes resulted in a more ro-bust amplification of the mutant allele and a less compet-ing reaction from the control,as evidenced by the relative intensities of the corresponding bands on agarose gel electrophoresis (Figure 2,bottom).Figure 2shows a side-by-side comparison of the modified and the original ARMS-PCR in detection of the JAK2mutation in two patient samples.The intensities of mutant products in both cases were significantly enhanced by the modified procedure.In patient 1,a band from the mutant allele can be seen when the patient DNA was diluted up to 1000-fold.In patient 2,the mutant allele was barely detectable in an undiluted DNA specimen by the original procedure but yielded a strong band that can be visualized even after 100-fold dilution.Taken together,the modifications enhanced the analytic sensitivity by approximately two orders of magnitude.

We verified modified ARMS-PCR results by the pyro-sequencing technique in 18clinical specimens in a blinded manner.As shown in Table 2,the modified ARMS

Table 1.

Comparison of PCR Conditions of the Original and Modified ARMS PCR Assays

Condition types Original

Modified

Reaction conditions dNTP

200?mol/L 120?mol/L Primer FO 1.0?mol/L 0.4?mol/L Primer RO 1.0?mol/L 0.3?mol/L Primer Fwt 0.5?mol/L 0.5?mol/L Primer Rmt

0.5?mol/L

1.0?mol/L DNA polymerase AmpliTaq Gold,1U HotStart,1U Template DNA 25ng 100ng Total volume 25?l

25?l

Cycling conditions Denaturing 94°C,1minute 94°C,30seconds Annealing 60°C,1minute 58°C,45seconds Extension 72°C,1minute 72°C,45seconds Cycle number

Original

Modified

M W

Patient 1Patient 2

U n d i l u t e d

1:10

1:100

1:1000Control Mutant Normal

U n d i l u t e d

1:10

1:100 1:1000200

600200

600Control Mutant Normal

Figure 2.The modified ARMS-PCR has a higher sensitivity than the original method.DNA samples from two patients were diluted with DNA from peripheral blood mononuclear cell at ratios of 1:10,1:100,and 1:1000.The positions of the DNA control,mutant,and normal alleles are indicated.MW,100-bp molecular weight markers.

Table 2.

Validation of the Modified ARMS-PCR Assay by Pyrosequencing

Specimens

Modified ARMS Pyrosequencing (%of mutant T allele*)

1Normal 02Normal 03Normal

4.34Mutant only 955Normal 2.66Normal 2.07Normal

2.18Mutant ?normal 2

3.79Mutant ?normal 3

4.310Mutant ?normal 39.811Mutant ?normal 58.512Normal 1.013Normal

0.914Mutant ?normal 70.115Mutant ?normal 27.716Normal 1.617Normal

1.018

Mutant ?normal

77.6

*Less than 5%of T by pyrosequencing is scored as normal.

274Chen et al

JMD April 2007,Vol.9,No.2

obtained results in 100%concordance with those ob-tained by pyrosequencing.Note that the lower detection limit of pyrosequencing quantitative assessment is 5%.Any peaks of the mutant T allele that were less than 5%were considered background noises rather than signals and were thus interpreted as normal.

To determine the analytic sensitivity of the assay,the HEL cell line that harbors homozygous V617F was serially diluted in peripheral blood mononuclear cells from a normal individual.As shown in Figure 3,a sensitivity of 0.05%was reached.To determine whether such sensi-tivity can be routinely reproduced,multiple runs were performed by several operators.Fresh serial dilutions were made and assayed in each run.Table 3shows 0.1%was achieved in all 14runs by four different operators,and 0.05%was achieved in 9of 10independent runs and 0.025%in four of eight independent runs.We conclude that the modified ARMS-PCR is highly sensitive and highly reproducible.

To ensure that the increased sensitivity does not give rise to false-positive results,samples from patients with nonmyeloproliferative disorders were tested for the JAK2mutation.Of 117DNA specimens,116were normal and one carried the V617F mutation,suggesting the diagnos-tic specificity of the assay is greater than 99%.At the present time,the significance of this positive finding in a patient who did not have MPD is unclear.On one hand,it is possible that the patient had MPD in its early stage that had not yet been detected by any other clinical or labo-ratory evaluations.The vast majority of the literature does not report finding the V617F mutation in normal individu-als or patients with reactive cytosis.However,given the

sensitive nature of our ARMS-PCR,it would not be sur-prising that cases of early MPD with a small evolving clone of tumor cells are revealed.On the other hand,it is equally possible that the result is false because of the high sensitivity of the ARMS-PCR assay.Indeed,low levels of the mutant allele have been identified in 5of 52normal volunteers by an extremely sensitive assay that combines locked nucleic acid with molecular beacon technology.With its ability to enrich the PCR products of the mutant allele,the method carries a sensitivity of 0.01%.15Apparently,the molecular beacon assay might be overly sensitive because it is unlikely that 10%of the population will eventually develop MPD.MPDs are con-sidered rare diseases (a few in 100,000),and epidemi-ology studies are currently ongoing to determine the actual incidence and prevalence of MPDs in the United States.Nevertheless,our ARMS-PCR assay does not seem to give rise to unusually high false-positive rate.With a sensitivity of 0.05to 0.1%,the diagnostic speci-ficity remains greater than 99%,which is generally ac-ceptable for a clinical test.

In summary,by changing the PCR reaction conditions,we developed an ARMS-PCR assay for clinical testing of the JAK2V617F mutation.During the preparation of this article,Vannucchi and colleagues 16published a report describing a JAK2ARMS-RT-PCR assay with a sensitivity of ?1%.The RT-PCR is coupled with capillary electro-phoresis and is able to determine normal and mutant allele in a relatively quantitative manner.However,the method has yet to be validated against an independent direct quantitative method such as pyrosequencing.In addition,the analyte is RNA,which is much more labile than DNA,and the step of reverse transcription is re-quired to convert RNA to cDNA.Currently,without a clearly demonstrated clinical utility of V617F levels,the DNA-based assay described here is probably more cost efficient in a clinical setting.We show that the test reaches a high sensitivity in the range of 0.05to 0.1%,which is among the highest reported in the literature.17The high sensitivity is beneficial in detecting the JAK2mutation in patients with a small proportion of the malig-nant cells as we have shown in Figure 2.Further,we have demonstrated that this high sensitivity is not accompa-nied by any significant compromise in the diagnostic specificity of the assay.In addition,the ARMS-PCR assay shows different patterns for normal,mutant,or mixed genotypes,minimizing the chance of misinterpretation.With simply one tube of PCR reactions and obviation for special equipment and reagents,ARMS-PCR represents a time-and labor-saving as well as cost-efficient method that is readily and broadly applicable in clinical molecular diagnostic laboratories.

References

1.Baxter EJ,Scott LM,Campbell PJ,East C,Fourouclas N,Swanton S,Vassiliou GS,Bench AJ,Boyd EM,Curtin N,Scott MA,Erber WN,Green AR:Acquired mutation of the tyrosine kinase JAK2in human myeloproliferative https://www.wendangku.net/doc/a89490187.html,ncet 2005,365:1054–1061

2.James C,Ugo V,Le Couedic JP,Staerk J,Delhommeau F,Lacout C,Garcon L,Raslova H,Berger R,Bennaceur-Griscelli A,Villeval

JL,

M W

100%

10%

0.5%

0.1%

0.05%

0.01%

H 2O

Control Normal

Mutant 600200

HEL/Control (%)

Figure 3.Analytic sensitivity of the ARMS-PCR assay.Genomic DNA from HEL cells was diluted with DNA from human peripheral blood mononuclear cell at indicated percentages.The positions of the DNA control,mutant,and normal alleles are indicated.MW,100-bp molecular weight markers.

Table 3.

Sensitivity and Reproducibility of the ARMS-PCR Assay

Staff member

HEL/control (%)

0.1%0.05%0.025%0.0125%A 6of 6*1of 20of 20of 2B 2of 22of 21of 20of 2C 2of 22of 22of 21of 2D 4of 44of 41of 20of 2Total

14of 14

9of 10

4of 8

1of 8

*x of y means that out of y number of test runs,x numbers of runs reached sensitivity indicated.

ARMS for the Detection of JAK2Mutation 275

JMD April 2007,Vol.9,No.2

Constantinescu SN,Casadevall N,Vainchenker W:A unique clonal JAK2mutation leading to constitutive signalling causes polycyth-aemia vera.Nature2005,434:1144–1148

3.Jones AV,Kreil S,Zoi K,Waghorn K,Curtis C,Zhang L,Score J,

Seear R,Chase AJ,Grand FH,White H,Zoi C,Loukopoulos D,Terpos E,Vervessou EC,Schultheis B,Emig M,Ernst T,Lengfelder E,Hehl-mann R,Hochhaus A,Oscier D,Silver RT,Reiter A,Cross NC: Widespread occurrence of the JAK2V617F mutation in chronic my-eloproliferative disorders.Blood2005,106:2162–2168

4.Kralovics R,Passamonti F,Buser AS,Teo SS,Tiedt R,Passweg JR,

Tichelli A,Cazzola M,Skoda RC:A gain-of-function mutation of JAK2 in myeloproliferative disorders.N Engl J Med2005,352:1779–1790 5.Levine RL,Wadleigh M,Cools J,Ebert BL,Wernig G,Huntly BJ,

Boggon TJ,Wlodarska I,Clark JJ,Moore S,Adelsperger J,Koo S, Lee JC,Gabriel S,Mercher T,D’Andrea A,Frohling S,Dohner K, Marynen P,Vandenberghe P,Mesa RA,Tefferi A,Griffin JD,Eck MJ, Sellers WR,Meyerson M,Golub TR,Lee SJ,Gilliland DG:Activating mutation in the tyrosine kinase JAK2in polycythemia vera,essential thrombocythemia,and myeloid metaplasia with myelofibrosis.Cancer Cell2005,7:387–397

6.Vainchenker W,Constantinescu SN:A unique activating mutation in

JAK2(V617F)is at the origin of polycythemia vera and allows a new classification of myeloproliferative diseases.Hematology(Am Soc Hematol Educ Program)2005:195–200

7.Campbell PJ,Scott LM,Buck G,Wheatley K,East CL,Marsden JT,

Duffy A,Boyd EM,Bench AJ,Scott MA,Vassiliou GS,Milligan DW, Smith SR,Erber WN,Bareford D,Wilkins BS,Reilly JT,Harrison CN, Green AR:Definition of subtypes of essential thrombocythaemia and relation to polycythaemia vera based on JAK2V617F mutation status:

a prospective https://www.wendangku.net/doc/a89490187.html,ncet2005,366:1945–1953

8.Campbell PJ,Griesshammer M,Dohner K,Dohner H,Kusec R,

Hasselbalch HC,Larsen TS,Pallisgaard N,Giraudier S,Le Bousse-Kerdiles MC,Desterke C,Guerton B,Dupriez B,Bordessoule D, Fenaux P,Kiladjian JJ,Viallard JF,Briere J,Harrison CN,Green AR,

Reilly JT:V617F mutation in JAK2is associated with poorer survival in idiopathic myelofibrosis.Blood2006,107:2098–2100

9.Tefferi A,Pardanani A:Mutation screening for JAK2V617F:when to

order the test and how to interpret the results.Leuk Res2006, 30:739–744

10.James C,Delhommeau F,Marzac C,Teyssandier I,Couedic JP,

Giraudier S,Roy L,Saulnier P,Lacroix L,Maury S,Tulliez M, Vainchenker W,Ugo V,Casadevall N:Detection of JAK2V617F as a first intention diagnostic test for erythrocytosis.Leukemia2006, 20:350–353

11.McClure R,Mai M,Lasho T:Validation of two clinically useful assays

for evaluation of JAK2V617F mutation in chronic myeloproliferative disorders.Leukemia2006,20:168–171

12.Jelinek J,Oki Y,Gharibyan V,Bueso-Ramos C,Prchal JT,Verstovsek

S,Beran M,Estey E,Kantarjian HM,Issa JP:JAK2mutation1849G?T is rare in acute leukemias but can be found in CMML,Philadelphia chromosome-negative CML,and megakaryocytic leukemia.Blood 2005,106:3370–3373

13.Steensma DP:JAK2V617F in myeloid disorders:molecular diagnos-

tic techniques and their clinical utility:a paper from the2005William Beaumont Hospital Symposium on Molecular Pathology.J Mol Diagn 2006,8:397–411

14.Jones AV,Silver RT,Waghorn K,Curtis C,Kreil S,Zoi K,Hochhaus A,

Oscier D,Metzgeroth G,Lengfelder E,Reiter A,Chase AJ,Cross NC: Minimal molecular response in polycythemia vera patients treated with imatinib or interferon alpha.Blood2006,107:3339–3341

15.Sidon P,El Housni H,Dessars B,Heimann P:The JAK2V617F muta-

tion is detectable at very low level in peripheral blood of healthy donors.Leukemia2006,20:1622

16.Vannucchi AM,Pancrazzi A,Bogani C,Antonioli E,Guglielmelli P:A

quantitative assay for JAK2(V617F)mutation in myeloproliferative disorders by ARMS-PCR and capillary electrophoresis.Leukemia 2006,20:1055–1060

17.Greiner TC:Diagnostic assays for the JAK2V617F mutation in chronic

myeloproliferative disorders.Am J Clin Pathol2006,125:651–653

276Chen et al

JMD April2007,Vol.9,No.2