当前位置：文档库 › 2010Bacterial community in the East Rongbuk Glacier,

2010Bacterial community in the East Rongbuk Glacier,

Microbiological Research 165(2010)

336—345

Bacterial community in the East Rongbuk Glacier,Mt.Qomolangma (Everest)by culture and culture-independent methods

Shu hong Zhang a,c ,Shu gui Hou b,c,?,Guang li Yang a ,Jian hui Wang c

Department of Life Science,Shangqiu Normal University,Shangqiu 476000,China

b School of Geographi

c an

d Oceanographic Sciences,Nanjing University,Nanjing 210093,China c

State Key Laboratory of Cryospheric Science,Cold and Arid Regions Environmental and Engineering Research Institute,Chinese Academy of Sciences,Lanzhou 730000,China

Received 25July 2009;accepted 9August 2009

KEYWORDS Bacteria;Abundance;

Community structure;East Rongbuk Glacier;Mt.Everest

Summary

The abundance of total and culturable bacteria deposited into the East Rongbuk ice core was investigated,and the bacterial content was examined through culture and culture-independent approaches.Total counts of bacteria in the ice core ranged from 0.02?103to 6.4?103cells ml à1.Viable bacteria varied between 0and 5.6CFU ml à1on PYGV and R2A media.The phylogenetic trees placed the culturable bacteria into four major groups:Actinobacteria ,Firmicutes ,Proteobacteria and Deinococcus -Thermus ,with Firmicutes being the most prevalent.They exhibited unique phenotypic properties with large and non-pigmented cells.The diversity revealed by H 0index of DGGE analysis was 0–0.75,and closer sections showed higher similarity of bacterial DNA structure.Members of two major lineages were found:Firmicutes and Proteobacteria .The combined culture and culture-independent methods indicated layer distribution of bacterial community in the ice core section,which might re?ect the ecological environments on glacier at time of their deposition.&2009Elsevier GmbH.All rights reserved.

Introduction

Mt.Qomolangma (Everest)is the world’s highest mountain.Because it is so far away from human habitation,features of the snow and glaciers on Mt.Everest can be taken as a mirror of natural environmental change (Kang et al.2002,2004).

www.elsevier .de/micres

?Corresponding author .

E-mail addresses:mariazhangsh@https://www.wendangku.net/doc/ec12426088.html, (S.h.Zhang),shugui@https://www.wendangku.net/doc/ec12426088.html, (S.g.Hou).

Xiong et al.(1999)isolated yeasts from two snow samples in Xixiabangma Peak,Himalaya and revealed that the number of bacteria were 6.9?106and 17.9?106cells/ml,respectively.Baghela et al. (2005)studied proteolytic bacteria in the cold Gangotri glacier,Western Himalaya,India.Y oshimura et al.(1997)examined the snow algae in a Himalayan glacier and the changes of algal biomass and community structure along the altitude gradient. Glacial ice is an intriguing habitat for studying ultra small prokaryotes,because it represents an extreme environment with low nutrient concentrations and subzero temperatures.The related researches will expand our knowledge of microbial diversity and provide insights into microbial survival for extended times.The availability of an ice core from the East Rongbuk(ER)Glacier provided a special opportunity to examine the diversity,survival,and possible activity of microorganisms present in ice.This study is a?rst attempt to describe the phylogenetic diversity of bacterial community isolated from deep glacial ice in Mt.Everest.Here we use traditional culture method to reveal the phenotypic character-istics of the ice core isolates.The different colony shape and pigment suggested their special mechan-isms,with which to adapt to the harsh environment. Culture-independent method of DGGE was used as well to have a better investigation of bacterial diversity.The two techniques were combined to have an understanding of the community distribution at different depths within the ice core. Materials and methods

Ice core sampling

A108.83m ice core(28.031N,86.961E),diameter 9.4cm,was drilled on the col of the ER Glacier at 6518m above sea level by using an electromecha-nical drill in a dry hole in September–October2002. The ice core was dated to1498–2055years BP, reported by Kaspari et al.(2007,2008).A total of 50samples were collected for bacterial cell concentrations,roughly proportionally but discon-tinuously along one half of the core.The vertical length of these samples was in the range 0.25–0.48m,with detailed depth description as Figure1.Among the50samples,13(Figure2)were analyzed for bacterial community diversity. Direct cell counts

In order to obtain reliable microbiological data, it is essential to eliminate the potential contam-ination caused during drilling,transportation,storage and sampling.This procedure was estab-lished according to Willerslev et al.(1999)and Christner et al.(2005),with minor modi?cation, described in detail as Zhang et al.(2008a). Treatment of samples by SYBR Green II(Mole-cular Probes,Inc.)was modi?ed from Yamagishi et al.(2003).Fifty milliliters of each sample were?xed in2%(vol/vol)glutaraldehyde buffered with phosphate-buffered saline(PBS)and then ?ltered onto25mm,0.2m m black track-etch membrane?lters(Whatman).Dimethyl sulfoxide (DMSO)was diluted with PBS to5%(vol/vol) as stock solution for SYBR Green II.Both SYBR Green II and the diluted DMSO were passed through 0.2m m?lters to remove extraneous particles and cells prior to analysis.Filtered samples were incubated with DMSO-buffered1g/l SYBR Green II for at least15min at201C in the dark.Afterwards the?lters were mounted onto a glass slide treated with mounting medium(1:1mixture of PBS diluted glycerin and0.1%p-phenylenediamine).Cells on the?lters were counted using an Olympus BH-2 microscope with a405nm argon laser at the?nal magni?cation of1000?.The total number of cocci and rods in60?elds of view was determined,and the number of cells per milliliter was calculated by computing the cumulative average cell per?eld (?eld of view area at1000?is16,741m m2). Bacterial isolation and culture

The remaining melted ice core samples (200–1100ml)were?ltrated through hydrophilic polyethersulfone membranes(Pall;0.22m m)with a vacuum pump(Ntengwe2005).Bacteria on the membranes were eluted by agitation for2min by hand,then by sonication for2min with a sonicator (model14;Branson Ultrasonics Corp.)(Uga et al. 2003)and then suspended in2.0ml PBS.Of the suspension,0.9ml was spread onto the surface of pre-cooled solid media of PYGV(http:// www.dsmz.de/media/med621.htm)and R2A (http://www.dsmz.de/media/med830.htm)con-taining low levels of nutrients,and triplicate plates were incubated at201C for about90d.Concentra-tions of culturable bacteria were estimated by counting the average colony formation units(CFU) per milliliter on each agar plate.Afterwards, representative bacterial colonies with visually different morphologies were picked and subcul-tured to obtain pure colonies.

16S rRNA analysis of isolates

The resulting pure bacterial colonies were picked with toothpicks and suspended in20m l sterile

Bacterial community in the East Rongbuk Glacier337

deionized water .Each suspension was heated to 961C for 10min to release DNA into the water (Saleena et al.2002).16S rRNA genes were PCR ampli?ed using the universal bacterial primers 27F (50-AGAGTTTGATCCTGGCTCAG-30)and 1492R (50-CGGTTACCTTGTTACGACTT-30)(Whitaker et al.2003).The ampli?ed reaction was performed with detailed protocol of Zhang et al.(2007).Reactions with mixtures containing sterile deionized water in place of genomic DNA were also carried out as negative controls.PCR product size was veri?ed by electrophoresis on 15g l à1agarose gels and quanti-?ed by UV spectrophotometer (UV 7501,T echcomp).RFLP analysis was performed by subjecting 16S rRNA gene to one of four base pair-cleaving restric-tion endonucleases (Hae III,Hha I and Sau 3AI;MBI)

digestion (15U/200to 400ng)for 3h at 371C.The fragments were analyzed in a 30g l à1agarose gel electrophoresis.Isolates with different ARDRA patterns had different 16S rRNA sequences and further sequenced using primers 27F (GGTAGAGTTT -GATCCTGGCTCAG),517F (CCAGCAGCCGCGGTAAT)and 907F (AAACTCAAATGAATTGACGGG)and a state-of-the-art ABI 3730XL96capillary sequencer .The sequences obtained have been deposited in the EMBL nucleotide sequence database under accession num-bers AM292058to AM292073.

Radiation resistance of zf-69-II

The radiation sensitivity of zf-69-II was deter-mined by preparing uniform cell suspensions with

29.15-29.47, 30.34-30.70

32.11-32.47

36.09-36.42, 37.89-38.2440.05-40.38, 41.10-41.55 43.15-43.45, 45.35-45.75

49.58-50.03 54.80-55.20 57.25-57.65 59.46-59.76 62.70-63.15 64.64-64.99 67.22-67.47 69.56-69.88 72.85-73.20 75.22-75.62 78.96-79.26 80.08-80.33 85.05-85.35 89.74-90.09 93.15-93.4597.03-97.3198.09-98.54 102.58-102.93 106.00-106.20106.96-107.31

104.34-104.79100.06-100.5197.51-97.84 94.98-95.4392.05-92.3587.02-87.27 83.88-84.36 79.59-79.94 76.34-76.64 74.54-74.89 71.25-71.55 68.21-68.66 65.33-65.71 63.69-63.99 62.00-62.38 58.41-58.86 55.64-55.94

52.95-53.25 48.56-48.86 32.47-32.72, 33.89-34.34Deinococcus -Thermus

1963.4-1962.5,1961.1-1960.51951.4-1950.7,1947.8-1947.61958.5-1958.1

1958.1-1957.8,1956.3-1957.11943.6-1942.9,1940.6-1939.11932.8-1931.7,1924.4-1923.31911.6-1910.11887-18851905.7-1903.61874-18721869-18671858-18571853-18511831-18281847-18451827-18251822-18211818-18161814-18121804-18031798-17951790-17891780-17781770-17681760-17571755-17521746-17441723-17211713-17121718-17151686-16821675-16711656-16541625-16211587-15841600-15961568-15631545-15421539-15361532-15231397-13911169-11471307-12791030-950

Acinotebacteria

Firmicutes

Alpha

Beta

Gamma

Year (AD)

1483-1470Figure 1.Distribution range of bacterial community from culture and uncultured approaches along the ice core depth.The core sections of 32.11–37.89and 59.46–75.22m were in gray corresponding to high dust concentration and warm periods of Little Ice Age (LIA).The sections of 43.15–55.64and 83.88–106.96m were in shallow gray corresponding to low dust concentration and cold periods of Little Ice Age (LIA).

S.h.Zhang et al.

338

logarithmic phase with OD540analysis.The above 0.6ml suspension was exposed to arti?cial254nm UV radiation by a UV-C lamp(OptiMair s,ACB-A, 30W)in Petri dishes in a1mm layer with continuous manual stirring(Sedliakova′and Sleza′r-ikova′1977).The intensity of radiation was20J mà2sà1.The exposure time of the bacteria to the UV light was:0,20,40,60,80,and100s.After each exposure time,0.2ml suspension was spread into R2A liquid medium with three replicates.The bacterial survival was determined according to the equation(Zhang2002)

Se%T?Z1=Z0?dilution times of cell suspension ?100%

where S is the survival rate,Z1is the OD540value after the UV-C treatment;Z0is the control one without UV-C treatment.

DNA extraction of ice core samples

Half of the suspension was used for the extrac-tion of genomic DNA according to Zhou et al. (1996).The pellets of crude nucleic acid were ?nally dried and resuspended in30m l of sterile deionized water and quanti?ed by UV spectro-photometer(UV7501,Techcomp).

PCR-DGGE analysis

Bacterial speci?c primers357F–GC and518R (Crump et al.2003)were used to amplify the V3hypervariable region of16S rRNA gene by PCR. Afterwards the puri?ed amplicons were used in DGGE analysis.The method was described in detail as Zhang et al.(2008a).

Statistical analysis of DGGE pro?les

The bands’positions in the DGGE pro?les corresponded to individual microbial identities, and the band intensities represented their relative quantities.The intensities of the bands in each DGGE pro?les were digitized by the software of Glyko BandScan5.0.The similarity among various samples was compared by cluster analysis with Minitab15.

Bacterial diversity was calculated with the Shannon–Weaver index(H0)from the DGGE band pro?les.H0was calculated according to the equation provided by Shannon and Weaver(1963) H0?à

P i ln P i

where P i was the importance probability of the bands in a lane,calculated from n i/N,where n i was the peak height of a band and N was the sum of all peak heights in the densitometric curve.

Recovery of bands from DGGE gels and sequence analysis

Analysis of the sequences and construction of trees were performed in detail as Zhang et al. (2008a).

Figure2.Silver nitrate stained DGGE pro?le of PCR product ampli?ed from16S rRNA(V3)gene with increasing depth of the108.83m ice core of ER Glacier.

Bacterial community in the East Rongbuk Glacier339

A total of 6partial sequences (lengths 194or 195bp)have been deposited in the EMBL nucleotide sequence database under the following accession numbers:AM292074to AM292079.

Results

T otal counts and culturability

T otal counts of bacteria in the ER ice core ranged from 0.02?103to 6.4?103cells ml à1(mean ?2.0?103cells ml à1,SD=2.2?103cells ml à1,n =50).Viable counts determined by CFU on PYGV and R2A agar at 201C varied from 0to 5.6CFU ml à1.The results indicated the culturable bacteria was only a fraction of viable microbial cell and less than 1%of the bacteria were cultivatable (Brinkmeyer et al.2003;Zhang et al.2008b ).

Phenotypic characterization of the isolates

After aerobic incubation,395visible colonies were recovered from the ice core samples.Pinkish colonies (yellow and pink)were rare,whereas white colonies were predominant ($95%).A few white ones had a slimy or gummy appearance.Eighty-four percent of the colonies were large and snow?ake shaped (Figure 3a).The remains were circular and uniform-edged,among which some were smooth (Figure 3b)or convex (Figure 3c).Only two colonies were rod shaped (Figure 3d).

Phylogenetic diversity of isolates

Among 395initially recovered colonies,150with visually different morphologies were subcultured to obtain pure colonies and RFLP analysis.Sixteen representatives with diverse ARDRA patterns were selected for subsequent 16S rDNA sequencing and phylogenetic analysis.The sequences obtained were af?liated with 4phylogenetic groups of Actinobacteri ,Firmicutes ,Proteobacteria and Dei-nococcus -Thermus (Figure 4),with Firmicutes being the dominance of 82%.

The most abundant organisms of Firmicutes fell into three major lineages (Figure 4):T wo isolates were af?liated with the genus Bacillus .zf-39-I and zf-71-I had 98%and 96%sequence similarity,respectively,to Bacillus megaterium (AY553118)retrieved from great salt plains of Oklahoma and Bacillus sp.9B_18(AY689066)from Lake Geum-gang.T wo isolates (zf-68-I and zf-93-I)were clustered together ,with 96%and 99%sequence similarity to Aerococcus viridans (AY707779)iso-lated from lobster pathogen,respectively.The remaining one of zf-35-I had Brevibacillus brevis (AY887081)recovered from soil as the nearest neighbor ,with 97%sequence similarity.

The next abundant isolates related to Actino-bacteria formed two subclusters supported by 100%bootstrap con?dence values.In one subcluster ,zf-47-II and zf-51-I were within the genus Kocuria ,with 99%sequence similarity to Kocuria palustris (AY881237)from deep sea mud and Kocuria sp.MT4.1(AY894331)from east and south coast of

Figure 3.Images of culturable aerobic bacteria isolated from the ER ice core:(a)snow ?ake-shaped zf-71-I,(b)circular ,smooth and uniform-edged zf-78-I,(c)circular ,convex and uniform-edged zf-68-I and (d)long rod-shaped zf-78-IV .

S.h.Zhang et al.

340

South Korea,respectively.In the other subcluster ,three isolates were af?liated with two species of the genus Microbacterium .zf-78-I and zf-98-I had 99.4%sequence similarity to each other and showed 97%sequence similarity to Microbacterium lacticum (X77441).

Isolates detected as Proteobacteria were grouped into alpha and gamma subdivisions.The organisms formed two subclusters within the a -Proteobacteria .The 16S rDNA sequence of zf-69-I was most closely matched to Brevundimonas sp.Tibet-IX23(DQ177489)from tundra on the Tibetan Plateau,with 98%sequence similarity.zf-34-I exhibited 99%sequence similarity with Rhodobacter massiliensis (AF452106).Three iso-lates related to the g -Proteobacteria formed two subclusters.In one subcluster ,zf-78-II and zf-104-II showed 99%and 94%sequence similarity to Acinetobacter sp.ANT9054(AY167273)from polar pack ice.Thus zf-104-II was possibly a new taxon within the Acinetobacter genus of the Proteobac-teria phylum.In the other subcluster ,zf-78-IV showed 99%similarity to Pseudomonadaceae bac-terium KVD-unk-78(DQ490324),from volcanic deposits.

The phylum Deinococcus -Thermus was less di-verse,with only one strain.zf-69-II and its most closely related species of Deinococcus radiodurans (M21413),resulted in sequence similarity of 96%.It was indicated that zf-69-II was possibly a new taxon within the Deinococcus .

Sensitivity of zf-69-II to UV radiation

When exponentially growing cells of zf-69-II were exposed to a ?ux of 20J m à2with radiation time of 0,20,40,6080,and 100s,the survival rate was 100%,90%,77%,32%,11%and 3%,respectively.Thus the isolate zf-69-II can endure maximum dose of 2000J m à2UV radiation.

Clustering analysis of DGGE patterns along the ice core depth

The DGGE pro?les are shown in Figure 2.Each lane of the DGGE pro?les contained approximately 7,8,4,8,7,2,1,2,2,2,3,3,and 3bands according to the order in Figure 2.H 0index varied in the range 0–0.75(mean ?0.41,SD ?0.19,n ?13).Dendrograms (Figure 5)generated by com-parisons of the banding patterns from the samples indicated low discrepancy between samples along the ice core depth,as shown by the high similarity indices (53.83–99.15%).Three distinct clusters were recognized.The DGGE pro?le of samples with ice core depth of 89.74–90.09,100.06–100.51and 102.58–102.93m clustered together;samples with ice core depth of 29.15–29.47,30.34–30.79,32.11–32.47,32.47–32.72,33.89–34.34,36.09–36.42,37.89–38.24,43.15–43.45,and 68.21–68.66m clustered into another major group;and sample in 49.58–50.03m depth clustered separately .It is indicated that patterns obtained from closer ice core depth generally shared more bands than patterns from more distant depth.Simultaneously ,the largest shift in community composition occurred in the samples of 49.58–50.03m depth.And samples with ice core depth of 89.74–90.09and 100.06–100.51m contained a very similar community pattern and differed signi?cantly from the rest of the ice core depth.

DGGE pro?les of bacterial community structures within the ice core depth

Obvious bands were excised from the gels and subjected to sequencing.Six 16S rRNA fragments,corresponding to positions 357-518of E.coli ,were successfully reampli?ed and sequenced (Figure 6).Sequenced fragments clustered into two major phylogenetic groups of Firmicutes and Proteobacteria .The most intense bands in the pro?les corresponded to g -proteobacteria group,which was observed almost throughout the ER ice core.The other groups of Firmicutes and b -Proteobacteria were also represented and detected in four and three different core sections,

Microbacterium sp. R1(AY974047)zf-106-II (AM292073)

Microbacterium lacticum (X77441)zf-98-I (AM292071)

zf-78-I (AM292067)

Kocuria palustris (AY881237)zf-47-II (AM292061)

Kocuria sp. MT4.1 (AY894331)

zf-51-I (AM292062)Bacillus megaterium (AY553118)

zf-39-I (AM292060)

Bacillus sp. 9B_18 (AY689066)zf-71-I (AM292066)

Aerococcus viridans (AY707779)

zf-93-I (AM292070)

zf-68-I (AM292063)Brevibacillus brevis (AY887081)zf-35-I (AM292059)

Deinococcus radiodurans (M21413)

zf-69-II (AM292065)

Brevundimonas sp. Tibet-IX23 (DQ177489)

zf-69-I (AM292064)

Rhodobacter massiliensis (AF452106)

zf-34-I (AM292058)

Acinetobacter sp. ANT9054 (AY167273)

zf-78-II (AM292068)zf-104-II (AM292072)

Pseudomonadaceae bacterium KVD-unk-78 (DQ490324)

zf-78-IV (AM292069)

100100100

34100100100100878363100

10010010010010078

7782100100100

980.02

Actinobacteri

Firmicutes

Deinococcus -Thermus Alpha -Proteobacteria Gamma -Proteobacteria

Figure 4.Neighbor-joining phylogenetic relationships of the isolates from the ER ice core and their nearest relatives based on Genbank 16S rRNA sequences.Only 450%bootstrap values (=1000replications)were indi-cated at nodes.Scale bar represents observed number of changes per nucleotide position.

Bacterial community in the East Rongbuk Glacier

341

respectively.The dominance of g -proteobacteria in the ER ice core was consistent to that in the Muztagh Ata ice core (Xiang et al.2004),water ,ice and sediment samples from the Bench Glacier of Alaska and the John Evans Glacier of Canada (Skidmore et al.2005).

Isolates detected as Proteobacteria were grouped into beta and gamma subdivisions.The organisms formed two subclusters within the g -Proteobacteria .T wo clones in one subcluster were af?liated with unculturable bacteria.zf-5-2exhibited 99%sequence similarity with uncultured bacterium (DQ001724).zf-4-1showed 95%and 94%sequence similarity to uncultured bacterium (AY354130)and uncultured Ectothiorhodospiraceae bacterium clone SIMO-942(AY710476),indicating that it was possibly a new taxon within the Ectothiorhodospiraceae genus of the Proteobacter-ia phylum.In the other subcluster ,the 16S rDNA sequence of zf-1-3was most closely matched to Acinetobacter sp.(AJ633642),with 100%similarity.One clone of zf-2-2was af?liated with the b -Proteobacteria ,and was mostly similar to either uncultured bacterium (AY938583)or uncultured Acidovorax sp.(AY177768),with 100%and 99%sequence identity,respectively.

In the Firmicutes group,zf-3-2and zf-6-4failed to exhibit a high sequence similarity to Caldaterra satsumae (AB250968)and Lentibacillus juripiscar-ius (AB127980)of less than 90%homology.The clones were possibly new genuses of the Firmicutes phylum,with currently ambiguous position.

49.58-50.0310

58-102.93100.06-100.5189.74-90.0936.09-36.4243.15-43.4530.34-30.7968.21-68.6632.11-32.4733.89-34.3432.47-32.7229.15-29.4737.89-38.24

53.83

69.22

84.61

100.00

S i m i l a r i t y (%)

Ice core depth (m)

Figure 5.Dendrograms constructed from DGGE-ampli?ed 16S rDNA (V3)gene of the 108.83m ER ice

core.

Figure 6.Neighbor-joining phylogenetic relationships of the clones obtained from DGGE bands of direct ampli?cation products from the ER ice core and their nearest relatives based on Genbank 16S rRNA sequences.Only 450%bootstrap values (=1000replications)were indicated at nodes.Scale bar represents observed number of changes per nucleotide position.

S.h.Zhang et al.

342

Discussion

Morphological and phenotypic characterization of the isolates

Many of the isolates recovered from other glaciers formed highly pigmented colonies(Christner et al.2000;Miteva et al.2004;Zhang et al.2008b). Our observation that a signi?cant population of large and non-pigmented cells existed in the melted ice was contrary to the assumption that some cells had an adaptive physiological response to environmental stress,including cell size reduc-tion and condensation of the cytoplasm(McDougald et al.1998),high frequency of pigment production to absorb harmful solar irradiation(Christner et al. 2000).Our result was consistent to that from the report of Skidmore et al.(2000).In that research, aerobic plating of unamended subglacial melt-waters from John Evans Glacier onto quarter-strength plate count agar yielded many colonies pigmented yellow or orange,while R2A medium-amended subglacial waters yielded colonies pre-dominantly non-pigmented.Therefore,our result was probably due to the choice of R2A medium,and also the complex survival strategies in the extreme environments.A better understanding of the processes that occur during the recovery or resuscitation of cells that have had low metabolic activity or have been dormant for extended times is of general importance to the isolation of organisms from environments other than ice cores.

In spite of the low sequence similarity of the isolate zf-69-II with that of D.radiodurans (M21413),its colony was red-pigmented and drought,which indicated that the isolate’s physio-logical properties may be consistent to the regions of the genome of D.radiodurans.Members of the family Deinococcaceae are best known for their ability to withstand extremely large amounts of ionizing radiation-induced damage to their DNA (Battista et al.1999).By using UV treat,we found that the maximum dose zf-69-II could endure was 67times of E coli(Zhang2004).Several rDNA sequences and cultured examples of Deinococcus-like organisms were previously obtained from Antarctic settings,including South Pole snow (Carpenter et al.2000)and Dry Valleys sandstones (de la Torre et al.2003).But it was not reported in the other Tibetan glaciers, e.g.Malan,Guliya, Muztagh Ata and Puruogangri.Such properties would be advantageous to organisms living in the adverse radiation environment of Himalayas.

The viable members of the bacterial content in the ER ice core may harbor special mechanisms that have allowed their adaptation to the harsh envir-onment.Further studies of the survival strategies and the conditions required for cell recovery and improvement of culturability are crucial to the exploration of life in other extreme environments, including extraterrestrial ones.

Comparison of the phylogenetic diversity of cultured and uncultured bacterial organisms Culture-independent molecular techniques could discover large numbers of sequences,which were absent or were poorly represented in a number of phyla through culture-dependent researches (Dunbar et al.1999;Kaiser et al.2001).In this study,bacterial content of the ice core was analyzed by culture and culture-independent ap-proaches in an effort to assess their cultivable component and their total biodiversity.Both culture and culture-independent approaches re-vealed the presence of g-Proteobacteria and Gram-positive bacteria Firmicutes.By culture-indepen-dent approach,we found that one phylotype,which was closely related to uncultured bacterium in the g-Proteobacteria,was a major part of the total bacterial community.Whereas the isolate zf-71-1 related to Bacillus sp.9B_18(AY689066)with96% sequence similarity was the major part revealed by culture approaches.The discrepancy between community analysis using culture and culture-inde-pendent methods was also revealed by Nold et al. (1996),Santegoeds et al.(1996)and Simbahan et al.(2005).The differences might be due to the use of synthetic medium that were different from the in situ habitats(Lulustyaningati et al.2008). Half of the sequences from DGGE analysis were similar to the uncultured eukaryote sequences,which also indicated the dif?culty for culture method to investigate bacterial community structure of envir-onmental samples.Thus,it is necessary to use a combination of different methods to search for signs of life in ancient icy formations,which might play a role in the long-term preservation and transportation of microbial life throughout the Universe.

Vertical distribution of cultured and uncultured bacterial community

In our previous research,there were two warm periods of Little Ice Age(LIA)from32.11to37.89m (1947–1958AD)and59.46to75.22m(1752–1847 AD),two cold periods of Little Ice Age(LIA)from 43.15to55.64m(1868–1932AD)and83.88to 106.96m(1054–1686AD)(Zhang et al.2008a). Members of different phylogenetic groups were

Bacterial community in the East Rongbuk Glacier343

predominantly isolated in ice from the above4 different core depths.Figure1showed the most frequently isolated bacterial phylotype recovered at different periods.Firmicutes,Actinobacteria and g-Proteobacteria were most frequently dis-tributed among the two warm and two cold periods.Whereas a-Proteobacteria,b-Proteobac-teria and Deinococcus-Thermus distributed mostly during warm periods with high dust concentration. Moreover,a-Proteobacteria,b-Proteobacteria were recovered only from the shallow part of the ice core(32.47–63.99m).The depth distribution of bacterial composition was also revealed in Malan (Xiang et al.2004),Muztagh Ata(Xiang et al.2005), Puruogangri(Zhang et al.2008b)and Geladiandong ice core(Yao et al.2008).The different distribution of bacterial community at different ice core depth may correlate with atmospheric circulation(Zhang et al.2007),dust concentration served as nutrients (Xiang et al.2004).In addition,the research about snow algae community on Glacier AX010on Hima-layas indicated the close relationship between glacial algal community and glacial summer mass balance(T akeuchi et al.1998).On Yala Glacier of Himalayas,the structure of algal community repre-sented by the proportion of each species to the total algal biomass also differed by altitude(Y oshimura et al.1997).Since the ice layers at different depths correspond to different periods with different climatic conditions,the distribution of microorgan-isms at different depths might re?ect the preferable ecological environments on glacier at time of their deposition,or the response of microorganisms to the variations of past climate and environment.

The composition and characteristics of the bacterial isolates might be related to the variation of climatic and environmental conditions.Cer-tainly,to evaluate more deeply the temporal and/or spatial variations in the diversity of ice core bacteria and to link shifts with natural or anthropogenic perturbations,more in-depth inves-tigations should be conducted considering more samples by employing both culture and molecular-based techniques in future work. Acknowledgements

This work was supported by Grants40825017and 40576001from the Natural Science Foundation of China,SKLCS-ZZ-2008-06.

References

Baghela VS,Tripathia RD,Ramtekeb PW,Gopal K, Dwivedi S,Jain RK,et al.Psychrotrophic proteolytic

bacteria from cold environment of Gangotri glacier, Western Himalaya,India.Enzyme Microb Technol 2005;36:654–9.

Battista JR,Earl AM,Park MJ.Why is Deinococcus radiodurans so resistant to ionizing radiation?.Trends Microbiol1999;7:362–5.

Brinkmeyer R,Knittel K,Jurgens J,Weyland H,Amann R, Helmke E.Diversity and structure of bacterial com-munities in Arctic versus Antarctic pack ice.Appl Environ Microbiol2003;69:6610–19.

Carpenter EJ,Lin S,Capone DG.Bacterial activity in South Pole snow.Appl Environ Microbiol2000;66: 4514–17.

Christner BC,Mikucki JA,Foreman CM,Denson J,Priscu JC.Glacial ice cores:a model system for developing extraterrestrial decontamination protocols.Icarus 2005;174:572–4.

Christner BC,Mosley-Thompson E,Thompson LG,Zagor-odnov V,Sandman K,Reeve JN.Recovery and identi?cation of viable bacteria immured in glacial ice.Icarus2000;144:479–85.

Crump BC,Kling GW,Bahr M,Hobbie JE.Bacterioplank-ton community shifts in an Arctic lake correlate with seasonal changes in organic matter source.Appl Environ Microbiol2003;69:2253–68.

de la Torre JR,Goebel BM,Friedmann EI,Pace NR.

Microbial diversity of cryptoendolithic communities from the McMurdo Dry Valleys,Antarctica.Appl Environ Microbiol2003;69:3858–67.

Dunbar J,Takala S,Barns SM,Davis JA,Kuske CR.Levels of bacterial community diversity in four arid soils compared by cultivation and16S rRNA gene cloning.

Appl Environ Microbiol1999;65:1662–9.

Kang S,Mayewski PA,Qin D,Yan Y,Hou S,Zhang D,et al.

Glaciochemical records from a Mt.Everest ice core: relationship to atmospheric circulation over Asia.

Atmos Environ2002;36:3351–61.

Kang S,Mayewski P,Qin D,Sneed SA,Ren J,Zhang D.

Seasonal differences in snow chemistry from the vicinity of Mt.Everest,central Himalayas.Atmos Environ2004;38:2819–29.

Kaiser O,Puhler A,Selbitschka W.Phylogenetic analysis of microbial diversity in the rhizoplane of oilseed rape (Brassica napus cv.Westar)employing cultivation-dependent and cultivation-independent approaches.

Microb Ecol2001;42:136–49.

Kaspari S,Mayewski P,Kang S,Sneed S,Hou S,Hooke R, et al.Reduction in northward incursions of the South Asian monsoon since1400AD inferred from a Mt.

Everest ice core.Geophys Res Lett2007;34:L16701, doi:10.1029/2007GL030440.

Kaspari S,Hooke R,Mayewski PA,Kang S,Hou S,Qin D.

Snow accumulation rate on Mt.Everest:synchroneity with sites across the Tibetan Plateau on50–100year timescales.J Glaciol2008;54:343–52. Lulustyaningati ANA,Madayanti FW,Aditiawati P,Akhma-loka.Culture-independent and culture-dependent approaches on microbial community analysis at Gedongsongo(GS-2)hot spring.Int J Integr Biol 2008;2:145–52.

S.h.Zhang et al.

344

McDougald DS,Rice A,Weichart D,Kjelleberg S.

Nonculturability:adaptation or debilitation?FEMS Microbiol Ecol1998;25:1–9.

Miteva VI,Sheridan PP,Brenchley JE.Phylogenetic and physiological diversity of microorganisms isolated from a deep Greenland Glacier ice core.Appl Environ Microbiol2004;70:202–13.

Ntengwe FW.An overview of industrial wastewater treatment and analysis as means of preventing pollution of surface and underground water bodies–the case of Nkana Mine in Zambia.Phys Chem Earth 2005;30:726–34.

Nold SC,Kopczynski ED,Ward DM.Cultivation of aerobic chemoorganotrophic proteobacteria and Gram-posi-tive bacteria from a hot spring microbial mat.Appl Environ Microbiol1996;62:3917–21.

Saleena LM,Rangarajan S,Nair S.Diversity of Azospir-illum strains isolated from rice plants grown in saline and nonsaline sites of coastal agricultural ecosystem.

Microb Ecol2002;44:271–7.

Santegoeds CM,Nold SC,Ward DM.Denaturing gradient gel electrophoresis used to monitor the enrichment culture of aerobic chemoorganotrophic bacteria from

a hot spring cyanobacterial mat.Appl Environ Micro-

biol1996;62:3922–8.

Sedliakova′M,Sleza′rikova′V.Repair,replication and survival in UV-irradiated Escherichia coli.Folia Micro-bioi1977;22:81–91.

Shannon CE,Weaver W.The mathematical theory of communication,2nd ed Urbana:University of Illinois Press;1963p.226.

Simbahan J,Kurth E,Schelert J,Dillman A,Moriyama E, Jovanovich S,et https://www.wendangku.net/doc/ec12426088.html,munity analysis of a mercury hot spring supports occurrence of domain-speci?c forms of mercuric reductase.Appl Environ Microbiol 2005;71:8836–45.

Skidmore ML,Foght JM,Sharp MJ.Microbial life beneath

a high Arctic glacier.Appl Environ Microbiol2000;

66:3214–20.

Skidmore M,Anderson SP,Sharp M,Foght J,Lanoil BD.

Comparison of microbial community compositions of two subglacial environments reveals a possible role for microbes in chemical weathering processes.Appl Environ Microbiol2005;71:6986–97.

Takeuchi N,Kohshima S,Fujita K.Snow algae community on a Himalayan glacier,Glacier AX010East Nepal: relationship with summer mass balance.Bull Glacier Res1998;16:43–50.

Uga S,Oda T,Kimura K,Kimura D,Setiawan K, Sri M,et al.Detection of microorganisms in Tapwater

in Indonesia and Thailand.Jpn J Trop Med Hyg 2003;31:87–91.

Whitaker RJ,Grogan DW,Taylor JW.Geographic barriers isolate endemic populations of hyperthermophilic Archaea.Science2003;301:976–8.

Willerslev E,Hansen AJ,Christensen B,Steffensen JP, Arctander P.Diversity of Holocene life forms in fossil glacier ice.Proc Natl Acad Sci1999;96:8017–21. Xiang S,Yao T,An L,Li Z,Wu G,Wang Y,et al.Change of bacterial community in the Malan Ice Core and its relation to climate and environment.Chin Sci Bull 2004;49:1869–75.

Xiang S,Yao T,An L,Xu B,Wang J.16S rRNA sequences and differences in bacteria isolated from the Muztag Ata Glacier at increasing depths.Appl Environ Micro-biol2005;71:4619–27.

Xiong K,Tang X,Xie S.Yeast isolated from snow at Tibet.

J Microbiol1999;19:58–62[in Chinese].

Yamagishi T,Hishinuma T,Kataoka H.Bicarbonate enhances synchronous division of the giant nuclei of sporophytes in Bryopsis plumose.J Plant Res2003;116:295–300.

Yao T,Liu Y,Kang S,Jiao N,Zeng Y,Liu X,et al.Bacteria variabilities in a Tibetan ice core and their relations with climate change.Global Biogeochem Cycles 2008;22:GB4017,doi:10.1029/2007GB003140. Yoshimura Y,Kohshima S,Ohtani S.A community of snow algae on a Himalayan glacier:change of algal biomass and community structure with altitude.Arctic Alpine Res1997;29:126–37.

Zhang S,Hou S,Ma X,Qin D,Chen T.Culturable bacteria in Himalayan ice in response to atmospheric circula-tion.Biogeosciences2007;4:1–9.

Zhang S,Hou S,Wu Y,Qin D.Bacterial diversity in Himalayan glacial ice and its relationship to dust.

Biogeosciences2008a;5:3433–56.

Zhang W.Investigation,collection,identi?cation and agricultural application of thermophiles from Taiwan local hot spring.PhD thesis,National Taiwan Univer-sity,Taipei,2004.

Zhang,X.Diversity of microorganisms and DNA entrapped in glacier ice of Qinghai-Tibet Plateau and its relation with environment.PhD thesis,Cold and Arid Regions Environmental Engineering Research Institute,Chi-nese Academy of Sciences,Lanzhou,China,2002. Zhang XF,Yao TD,Tian LD,Xu SJ,An LZ.Phylogenetic and physiological diversity of bacteria isolated from Puruogangri ice core.Microb Ecol2008b;55:476–88. Zhou J,Bruns MA,Tiedje JM.DNA recovery from soils of diverse composition.Appl Environ Microbiol1996;62: 461–468.

Bacterial community in the East Rongbuk Glacier345