AECS
Stem Cells 2005;23:1549–1559 https://www.wendangku.net/doc/e013618762.html,
Correspondence: Stephen C. Strom, Ph.D., Department of Pathology and McGowan Institute for Regenerative Medicine, University of Pittsburgh, 200 Lothrop St., BST-s450, Pittsburgh, Pennsylvania 15261, USA. Telephone: 412-624-7715; Fax: 412-383-7969; e-mail: strom@https://www.wendangku.net/doc/e013618762.html, Received December 15, 2004 ; accepted for publication May 27, 2005; first published online in Stem Cells E XPRESS August 4, 2005. ?AlphaMed Press 1066-5099/2005/$12.00/0 doi: 10.1634/stemcells.2004-0357
Introduction
The placenta is comprised of three layers: amnion, chorion, and decidua. Each layer is derived from vastly different sources. Although the decidua is maternally derived, the amnion and cho-rion are derived from the embryo. Whereas the chorion is derived from the trophoblast layer, the amnion is derived from the epiblast as early as 8 days after fertilization. Thus, the epiblast gives rise to the amnion as wellto as to all of the germ layers of the embryo. Pluripotent embryonal carcinoma cells can only be produced from cells derived before gastrulation [1], confirming the impor-tance of gastrulation in the differentiation and specification of cell fate. Gastrulation occurs approximately 3 weeks after fertil-ization, which is nearly 2 weeks after amniotic epithelial (AE) cells are formed from the epiblast. Thus, amnion may retain the pluripotent properties of early epiblast cells.
The amnion is a thin membrane-lined cavity that fills with fluid and serves, among other things, to cushion the fetus during
development and to prevent adhesion of the developing fetus to maternal structures. AE cells have several unique characteristics. Like many immature or stem cells, expression of myosin heavy chain class I antigens is very low on AE cells [2, 3]. Under certain conditions, AE cells have been reported to differentiate to mature neural cells that synthesize and release neurotransmitters, includ-ing acetylcholine, norepinephrine, and dopamine [4, 5]. These observations suggest that cells derived from the fetal side of the placenta may retain a multipotent phenotype long after they dif-ferentiate from the epiblast. In support of this hypothesis, recent reports have described the identification of pluripotent or mul-tipotent stem cells from human placenta cord blood or amniotic fluid [6–11]. Pluripotent stem cells were identified in cord blood [7], whereas multipotent mesenchymal stem cells were detected in various placental tissues [6, 9, 10]. Mesenchymal stem cells have also been isolated from amniotic fluid [11, 12].
1550Multipotent Cells from Amnion
Taken together, these observations suggest that the fetal tis-sues of the placenta might be a useful source of stem or progeni-tor cells. We examined the epithelial cell layer of the amnion for cells with stem cell characteristics. The results indicate that the amnion contains cells with significant plasticity and differentia-tion potential. If methods can be developed for the efficient dif-ferentiation of amnion-derived cells to specific cell types, this placental tissue, which is normally discarded, may be a useful source of cells for transplantation and regenerative medicine.
Materials and Methods
Isolation of AE Cells
In brief, human placentae were obtained with the approval of the institutional review board, University of Pittsburgh, after uncomplicated elective caesarean deliveries from healthy mothers. Amnion layer was prepared according to the meth-ods previously described by Akle et al. [2] with the following modifications. The amnion layer was mechanically peeled off of the chorion and washed several times with Hanks’ balanced salt solution (HBSS) without calcium and magnesium to remove blood. To release AE cells, the amnion membrane was incubated at 37°C with 0.05% trypsin containing 0.53 mM EDTA4Na (Gibco, Grand Island, NY, https://www.wendangku.net/doc/e013618762.html,).The cells from the first 10 minutes of digestion were discarded to exclude debris. The cells from the second and third 30-minute digests were pooled and washed three times with HBSS. Viabil-ity of the AE cells was determined by exclusion of trypan blue dye and counted with a hemocytometer.
Cell Culture and Standard Culture Media
AE cells were plated on 100-mm-diameter cell culture dishes at a density of 12.7 × 104 cells per cm2 in our standard culture media containing 10 ng/ml epidermal growth factor (EGF) (BD Biosci-ences, Franklin Lake, NJ, https://www.wendangku.net/doc/e013618762.html,). EGF was defined in preliminary experiments to induce robust proliferation. Within 24–48 hours, AE cells achieved >80% confluency, and the cells were dissociated by trypsin and plated at a density of 1 × 104 cells per cm2 on culture dishes for further differentiation protocols. Standard culture media is Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 2 mM L-gluta-mine, 1% nonessential amino acid, 55 μM 2-mercaptoethanol, 1 mM sodium pyruvate, and 1% antibiotic-antimycotic (all from Gibco). This standard media may be supplemented with a variety of growth factors as indicated in the text.
Isolation of Attached and Intermediate Layers
from AE Cultures
AE cells were isolated and plated under our standard culture con-ditions on 100-mm-diameter culture dishes at a density of 1 × 107 cells per dish. After 5 days in culture, the cells in the supernatant, cells in the intermediate layer, and cells attached to the culture dish were collected as separate fractions. The supernatant fraction was collected from aspirated media and washed with HBSS. The mid-dle- or intermediate-layer cells were released with trypsin under careful microscopic observation. Adherent cells attached to the culture dish were isolated by more extended trypsinization.
Fluorescence-Activated Cell Sorter Analysis
Freshly isolated AE cells were examined for surface antigens commonly found on embryonic stem cells (ESCs) [13, 14]. The following specific primary monoclonal antibodies (2 μg/ml each) were used to detect surface-antigen expression: SSEA-1 (MAB4301), SSEA-3 (MAB4303), SSEA-4 (MAB4304), TRA1-60 (MAB4360), TRA 1-81 (MAB4381), TRA 2-54 (MAB4354) (all from Chemicon, Temecula, CA,http://www. https://www.wendangku.net/doc/e013618762.html,), Thy1.1 (BD Pharmingen, San Diego, http:// https://www.wendangku.net/doc/e013618762.html,/pharmingen), c-kit, (Miltenyi Bio-tec, Bergisch Gladbach, Germany, https://www.wendangku.net/doc/e013618762.html,tenyibiotec. com), and CD34 (DakoCytomation, Glostrup, Denmark, https://www.wendangku.net/doc/e013618762.html,). Isotype immunoglobu-lins for each antibody were used as negative controls (all from DakoCytomation). When needed, fluorescein isothiocyanate (FITC)–labeled goat anti-mouse immunoglobulin M (IgM) (eBioscience, San Diego, https://www.wendangku.net/doc/e013618762.html,), IgG (Chemicon), and anti-rat IgM (eBioscience) were used as sec-ondary antibodies. Cells were prepared at 1 × 106 cells/ml in HBSS and were analyzed on a flow cytometer (Coulter Epics XL MCL/Expo32; Becton, Dickinson and Company, Franklin Lakes, NJ, https://www.wendangku.net/doc/e013618762.html,). Propidium iodide (PI) stain-ing was performed (0.5 μg/1 × 106 cells; BD Pharmingen). Gat-ing was set to exclude as many PI-positive cells as possible. The gated areas contained less than 1.2% PI-positive cells. A mini-mum of 10,000 events was acquired for each sample.
Immunohistochemistry
Cells cultured on collagen-coated cover glasses (CR18) were fixed in cold acetone (?20°C) for 2 minutes. Cells were rinsed with phosphate-buffered saline (PBS) twice and incubated in protein-blocking agent (Immunon #407501) for 20 minutes. Samples were incubated with primary antibodies Pan-cytokera-tin (10 μg/ml; Santa Cruz Biotechnology Inc., Santa Cruz, CA, https://www.wendangku.net/doc/e013618762.html,), desmin (1:100, clone D33; DakoCytoma-tion), smooth muscle actin (1:100, clone 1A4; DakoCytomation), albumin (1:1,000, HSA11; Sigma-Aldrich, St. Louis, http://www. https://www.wendangku.net/doc/e013618762.html,), HNF-4α (1:20, C-19; Chemicon), glucagon (1:20; Chemicon), c-peptide (1:10; Linco Research, St. Charles, MO, https://www.wendangku.net/doc/e013618762.html,), proinsulin (1:200; Vec-tor Laboratories, Burlingame, CA, https://www.wendangku.net/doc/e013618762.html,), glial fibrillary acidic protein (GFAP) (prediluted; Biogenesis, Poole, U.K., https://www.wendangku.net/doc/e013618762.html,), cyclic nucleotide phosphodiesterase (CNP) (1:100; Chemicon), α-actinin (1:800,
Miki, Lehmann, Cai et al. 1551
https://www.wendangku.net/doc/e013618762.html,
A7811; Sigma-Aldrich), alpha 1 anti-trypsin (A1AT) (prediluted; Biomeda, Foster City, CA, https://www.wendangku.net/doc/e013618762.html,), or isotype con-trols for each antibody (all from DakoCytomation) for 16 hours at 4°C. Dilution buffer only (PBS/1% bovine serum albumin) was also added as negative control for the secondary antibody in each experiment. The samples were rinsed with PBS twice and incubated with FITC- or Cy3-conjugated secondary anti-bodies for 2 hours at room temperature. Cells were rinsed with PBS and mounted with aqueous mounting medium with DAPI (4,6 diamidino-2-phenylindole; Vector Laboratories) for nuclear counterstaining. In some experiments, biotinylated secondary antibodies and an avidin-biotinylated enzyme complex system (Vectastain Elite ABC Kits) with a DAB substrate kit (Vector Laboratories ) were used to visualize positive cells followed by hematoxylin nuclear counterstaining. Alkaline phosphatase reaction was performed following the manufacturers’ instruc-tions (SK-5100; Vector Laboratories).
Laser-Scanning Confocal Microscopy
Naive AE cells were cultured on collagen-coated coverslips (CR18) at a density of 5 × 104 cells per cm 2 for 10–14 days. When spheroid formation was observed, samples were fixed with 2% paraformaldehyde for 20 minutes at room temperature and sub-sequently permeabilized by 0.1% triton X in PBS for 20 min-utes at room temperature. After blocking and washing steps, the samples were incubated with anti–stem cell marker antibodies SSEA-3 (10 μg/ml), SSEA-4 (5 μg/ml), TRA 1-60 (10 μg/ml), TRA 1-81 (10 μg/ml) (all from Chemicon), and Oct-4 (2 μg/ml, C-10; Santa Cruz Biotechnology Inc.) overnight at 4°C. The cells were washed and incubated with the corresponding secondary antibodies conjugated with FITC for 45 minutes at room tem-perature in the dark. For counterstaining, rhodamine phalloidin (Molecular Probes Inc., Eugene, OR, https://www.wendangku.net/doc/e013618762.html,) 0.8 U/ml and nuclear binding compound DRAQ5 (Biosta-tus, Leicestershire, U.K., https://www.wendangku.net/doc/e013618762.html,) 2.5 μM were used to visualize F-actin and nuclear, respectively. Cov-erslips were mounted and analyzed by confocal microscopy. Image galleries were acquired at 0.5- to 0.7-μm intervals on the Z -axis. Experiments were performed with an Olympus Fluoview BX61 laser-scanning microscope (Olympus, Tokyo, https://www.wendangku.net/doc/e013618762.html,), equipped with a ×40 oil objective (NA 1.3). Data analysis was performed with MetaMorph (version 6.1r3; Universal Imaging Ltd., Buckinghamshire, U.K., https://www.wendangku.net/doc/e013618762.html,) software.
One-Step Reverse Transcription–Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction
Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA, https://www.wendangku.net/doc/e013618762.html,). RNA concentrations were measured by absorbance at 260 nm with a spectrophotometer, and 2 μg of DNase I–treated RNA of each sample served as a template for a SuperScript One-Step reverse transcription–polymerase chain reaction (RT-PCR) system (Invitrogen). The RNA templates were amplified at 33 to 45 cycles of 94°C (30 seconds), 58°C to 61°C (30 seconds), 72°C (1 minute), followed with 72°C for 10 minutes. PCR products were visualized with ethidium bromide on a 3% agarose gel. Product sizes, annealing temperatures, and primer sequences are listed in Table 1. Real-time quantitative RT-PCR was conducted on an ABI Prism 7700 (Applied Biosystems, Foster City, CA, https://www.wendangku.net/doc/e013618762.html,). Two micrograms of DNase-I–treated total RNA of each sample were transcribed and mixed with specific primer sets and PCR master mix (#4312704; Applied Biosystems). Nanog mRNA expression was analyzed by SYBR green fluo-rescence with three different primer sets (Table 1), and the PCR products were confirmed by sequencing. TaqMan analysis was used for Oct-4 (Hs00742896_s1), albumin (Hs00609411_m1), anti-A1AT (Hs00165475_m1), C/EBP α (Hs00269972_s1), and β-actin (Hs99999903_m1) gene expression analysis with primers and conditions designated by Assays on Demand, Gene Expression Products (Applied Biosystems). Data were analyzed with the ABI Prism 7700 SDS software (version 1.0). Expres-sion of specific genes was normalized to an internal control (beta-actin) mRNA expression.
Tumorigenicity
Cells were examined for tumorigenicity by injection of 1 million cells per site into the rear leg muscles (n = 3) and/or the testis (n = 2) of severe combined immunodeficiency (SCID)/beige mice and into the liver (n = 10) and/or the interscapular fat pad (n = 5) of Rag-2 knockout (?/?) mice in 100 μl of PBS using a 30-gauge nee-dle. Animals were observed for up to 7 months with no evidence of tumor formation, whereas the transformed cell line (HepG2) formed tumors in approximately 2–3 weeks.
In Vitro Differentiation Culture Conditions
For hepatic differentiation, freshly isolated AE cells were allowed to proliferate for 1 week and were subcultured on six-well plates coated with type 1 collagen. Dexamethasone (10?7 M) and insulin (0.1 μM) were added in cultures to enhance hepatic differentia-tion. Phenobarbital (1 mM) was added for the final 3 days, and RNA was isolated. Pancreatic differentiation of AE cells was accomplished by culturing cells for 14 days with standard media supplemented with nicotinamide (10 mM; Sigma-Aldrich). Neu-ral differentiation was accomplished in standard media supple-mented with 5 × 10?5 M all-trans retinoic acid (Sigma-Aldrich) and fibroblast growth factor (FGF)-4 10 ng/ml (R&D Systems Inc., Minneapolis, https://www.wendangku.net/doc/e013618762.html,), whereas car-diomyocyte differentiation was accomplished by culturing cells for 14 days in standard media supplemented with 1 mM ascorbic acid 2-phosphate (Sigma-Aldrich).
1552Multipotent Cells from Amnion Table 1. Primer sequences and the condition of reverse transcription–polymerase chain reaction
Primer Sequence (5'→3')Product size (bp)Annealing
temperature (?C)Cycles
Oct-4Octamer-binding protein 3/4gaggagtcccaggacatgaa1515745
gtggtctggctgaacacctt
Sox-2SRY-related HMG-box 2gccgagtggaaacttttgtc2645733
gttcatgtgcgcgtaactgt
FGF-4Fibroblast growth factor 4ctacaacgcctacgagtcctaca3705745
gttgcaccagaaaagtcagagttg
Rex-1Reduced expression-1 gcgtacgcaaattaaagtccaga3065733
cagcatcctaaacagctcgcagaat
TERT Telomerase reverse
transcription
agagtgtctggagcaagttgc1855745
cgtagtccatgttcacaatcg
Pdx-1Insulin promoter factor 1ttagaccgaaggggaaaacc2675940
ttagggagccttccaatgtg
PAX-6Paired box gene 6ccggcagaagattgtagagc3235940
ctagccaggttgcgaagaac
Nkx-2.2Homeobox protein NK-2
homologue B
gaagaaccccttctacgaca2165940
tcgccgctttcgcttcttg
insulin gcctttgtgaaccaacacctg2615940
gttgcagtagttctccagctg
glucagon gagggcttgctctctcttca2365940
gtgaatgtgccctgtgaatg
NSE Neurone-specific enolase cccactgatccttcccgatacat2545745
ccgatctggttgaccttgagca
NF-M Neurofilament medium
polypeptide
gagcgcaaagactacctgaaga4305745
cagcgatttctatatccagagcc
MBP Myelin basic protein ttagctgaattcgcgtgtgg3795745
gaggaagtgaatgagccggtta
nestin cagctggcgcacctcaagatg2085745
agggaagttgggctcaggactgg
GAD Glutamate decarboxylase gcgccatatccaacagtgacag2845745
gccagcagttgcattgacataa
GATA-4GATA binding protein 4ccaagcaggactcttggaac2635733
cagcgtgtaaaggcatctga
Nkx 2.5tataacgcctaccccgcctat4205733
taatcgccgccacaaactctcc
MLC-2A Atrial myosin light chain acagagtttattgaggtgcccc3815745
aaggtgaagtgtcccagagg
MLC-2V Ventricular myosin light
chain
tattggaacatggcctctggat3825745
ggtgctgaaggctgattacgtt
β-actin cgcaccactggcattgtcat2085735
ttctccttgatgtcacgcac
For real-time polymerase chain reaction
Nanog (1)ctcagcctccagcagatgc15060
ccttctgcgtcacactg
Nanog (2)tccccaaagcttttg45860
ggccagttgtttttctgcc
Nanog (3)ctgygatttgtgggcctgaa15360
tgtttgcctttgggactggt
β-actin aggcatcctcaccctgaagta10560
cacacgcagctcattgtaga
Miki, Lehmann, Cai et al. 1553
https://www.wendangku.net/doc/e013618762.html,
EROD Assay
Cytochrome P450-1A1/2 activity was assessed by the conversion of Ethoxyresorufin to resorufin (ethoxyresorufin-o-deethyl-ase) (EROD) [15]. AE-derived hepatocyte-like cells and human hepatocytes were exposed to β-naphthoflavone (10 μM) for 48 hours before analysis. Cells were incubated with 20 μM EROD and 2.5 mM salicylamide (all from Sigma-Aldrich) for 1 hour. Two hundred microliters of media was analyzed on a fluorimet-ric spectrometer (LS50B; PerkinElmer Life Sciences, Boston, https://www.wendangku.net/doc/e013618762.html,) at an excitation wavelength of 535 nm and an emission wavelength of 581/5 nm. Ethoxyresorufin-containing media was added to cultures without cells to serve as a negative control.
Results
Stem cell surface markers are present on isolated AE cells. AE cells express SSEA-3 (8.79% ± 2.84%), SSEA-4 (43.94% ± 14.8%), TRA 1-60 (9.82% ± 4.31%), and TRA 1-81 (9.91% ± 4.49%) and do not express SSEA-1 (Fig. 1A). Some AE cells express c-kit, the surface receptor for stem cell factor, and Thy-1 [16, 17]. Although initially low, approximately 50% of the cells express Thy-1 after 6 days of culture (not shown). The cells do not express the hematopoietic stem cell marker CD34. The absence of CD34-positive cells in this population indicates the isolates are not contaminated with hematopoietic stem cells such as umbilical cord blood or embryonic fibroblasts. The results presented are the average values from five different donors.
In the presence of EGF, AE cells proliferate robustly and form a confluent monolayer of cobblestone-shaped epithelial cells (Fig. 1B). Approximately five cell doublings were observed over 8 days, giving these cells an average doubling time of 38.4 hours in the presence of EGF. Without EGF, proliferation ceased and the cells formed multinucleated giant cells reminiscent of tropho-blast differentiation of ESCs [18]. Proliferating AE cells showed a normal karyotype (not shown). As shown in Figure 1C, like
the single layer of epithelial cells from the amniotic membrane (inset), the cells react with antibodies to pan-cytokeratins, con-firming their epithelial nature and the lack of contamination with
other cell types, such as mesenchymal fibroblasts.
Figure 1. Analysis of stem cell markers on AE cells. (A): Data pres-ent the average level of cell surface antigen expression of isolated AE cells (n = 5, ± SD) measured by immunofluorescence and flow cytometry. (B): Phase-contrast microscopic images of cultured AE cells with or without EGF (10 ng/ml). Scale bar = 100 μm. (C): Immunohistochemical detection of cytokeratin in cultured AE cells. Insets show a section of amniotic tissue. Mouse IgG1 antibody was used as a negative control. Hematoxylin nuclear counterstaining was performed. (D): Reverse transcription–polymerase chain reac-tion analysis of AE cells. Stem cell–specific gene primers were used. (E): Expression of Oct-4 and nanog (relative to a beta-actin internal control) in cultured AE cells over the first 18 days after isolation. For this analysis, gene expression in the starting material was set to 1. Spheroid formation was evident in confluent cultures as early as day 6. Abbreviations: AE, amniotic epithelial; ck, cytokeratin; EGF, epi-dermal growth factor; FGF, fibroblast growth factor; Oct-4, octamer-binding protein 4; TERT, telomerase reverse transcription.
1554 Multipotent Cells from Amnion
In addition to the SSEA and TRA surface markers, there is consensus agreement that human embryonic stem cell (hESC) lines express telomerase, Oct-4, SOX-2, FGF-4 [19], and Rex-1. Freshly isolated AE cells were examined for these markers. The human hepatoblastoma cell line HepG2 cells served as the con-trol. With the exception of telomerase, all other stem cell markers were expressed on freshly isolated AE cells (Fig. 1D). Telomerase RT expression was detected in HepG2 but not in AE cells. Neither was telomerase activity detectable in AE cells by the TRAP assay (Trapez telomerase detection kit; InterGen, Burlington, MA, https://www.wendangku.net/doc/e013618762.html,, data not shown).
Isolated AE cells express Oct-4 and nanog, two genes known to be required for self-renewal and pluripotency [20, 21]. The expression of nanog was confirmed by the use of three different primer sets and sequencing the amplified product. Both genes were readily detected in AE cells at the time of isolation. When AE cells were kept in high-density culture, the expression of Oct-4 and nanog increased over the first 12–15 days as AE cells formed spheroid structures above the basal layer (Fig. 1E). Suspecting that the stem cell markers may be derived from the cells in the spher-oids, the expression of the stem cell markers was examined in these structures. As shown in Figure 2A, metabolism of a fluores-cent substrate by alkaline phosphatase was restricted to the cells within the spheroids. Immunofluorescent staining and confocal microscopy revealed that the stem cell surface antigens SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 were also localized to the spheroids (Fig. 2B), whereas 98% of the basal layer cells under the spheroid structure did not react. Nearly 100% of the cells in spher-oids reacted with antibodies to SSEA-4, whereas 5%–15% of the cells in spheroids were positive for SSEA-3, TRA1-60, or TRA1-81. Nuclear localization of Oct-4 was evident within the sections of the spheroids visualized by confocal microscopy, confirming the RNA data (Fig. 2C). Cells at the middle level of the spheroid showed both nuclear and cytoplasmic staining. These data sug-gest that some cells in the spheroid structures retain their initial stem cell characteristics and that stem cell markers are reduced when the cells attach to culture dishes.
After 5 days in culture, the cells floating in the media (Sup) were removed by aspiration of the media. Clusters of cells attach-ing loosely over the adherent cells (Mid) and those cells attached to the culture dish (adherent fractions) were collected by differ-ential trypsinization (Fig. 3A). Some of the collected cells were stained for stem cell surface markers, and the remainder were used for RT-PCR analysis. The expressions of Oct-4 and nanog were examined by quantitative real-time RT-PCR. The results clearly indicate that the nanog and Oct-4 expression is higher in the cells in the middle layer of the cultures than in the adherent fraction (Fig. 3B). The middle cell fraction also contained more cells that express the stem cell surface markers SSEA-4, TRA1-60, and TRA 1-81 than the cells adherent to the culture dish.
There was no significant difference in the expression of SSEA-3
Figure 2. Examination of stem cell markers on spheroids. Scale bar = 100 μm. (A): Phase-contrast and fluorescent microscopic view of a spheroid and basal layer cells observed after incubation with vector red, a fluorescent alkaline phosphatase (ALP) substrate. (B): Cells in the spheroids were incubated with antibodies to stem cell surface markers, and confocal images were taken at sections through the spheroid indicated in the side and bottom views. Stem cell markers SSEA-3, SSEA-4, TRA1-60, and TRA 1-81 were all visualized with a fluorescein isothiocyanate–conjugated second-ary antibody (green), f-actin was stained with rhodamine phal-loidin (red) to visualize the spheroid structure, and nuclei were counterstained with DRAQ5 (blue). TRA 1-60–positive and TRA 1-81–positive cells are indicated with a yellow arrow. (C): Confocal microscopic images of a spheroid after incubation with an antibody to Oct-4 (green). Cells at the middle level of the spheroid showed both nuclear and cytoplasmic staining. Structural and nuclear coun-terstaining are the same as in (B).
Miki, Lehmann, Cai et al. 1555
https://www.wendangku.net/doc/e013618762.html,
(Fig. 3C). These data suggest that cells remaining in culture over the basal layer of adherent cells contain more cells with stem cell characteristics than the adherent fraction.
Because undifferentiated ESCs induce tumor formation upon transplantation, we examined the tumorigenicity of AE cells by injection of 1 million cells per site into the rear leg mus-cles (n = 3) and/or the testis (n = 2) of SCID/beige mice and into the liver (n = 10) and/or the interscapular fat pad (n = 5) of Rag-2?/? mice in 100 μl of PBS using a 30-gauge needle. Although AE cells showed some stem cell characteristics, when a total of 23 million cells (1 million cells per site) were injected into immu-nodeficient SCID/beige or Rag2?/? mice, none of the recipients developed tumors.
Animals were observed for up to 7 months with no evidence of tumor formation, whereas tumors were observed in animals transplanted with the transformed cell line (HepG2) in approxi-mately 2–3 weeks.
Because AE cells do not form teratocarcinomas, the exami-nation of the ability of AE cells to differentiate to cells from all three germ layers was conducted in vitro. We focused our studies on four cell types that are among those most useful for cell therapy. Endodermal (pancreatic) lineage differentiation of AE cells was examined. As shown by RT-PCR analysis (Fig. 4A), freshly isolated AE cells express pancreas duodenum homeobox-1 and the mRNA expression is maintained when AE cells are cultured in the presence of nicotinamide [22]. The expression of the downstream transcription factors paired box homeotic gene 6, the NK2 transcription factor–related locus 2 (Nkx 2.2), and the mature hormones insulin and glucagon was induced when AE cells were cultured with nicotinamide. Immunostaining for glucagon was also observed (Fig. 4A), sug-gesting that culture treatments enhance pancreatic differentia-tion of AE cells. These data indicate that under specific con-ditions, AE cells differentiate to endodermal cells. Under the same conditions, immunoreactivity to proinsulin or c-peptide could not be demonstrated.
Next, neural differentiation was examined. AE cells were cultured in media supplemented with all-trans retinoic acid and FGF-4 for 7 days to induce neural-specific gene expression (ecto-dermal lineage) [23, 24]. Like hESCs, freshly isolated AE cells express many markers of neural differentiation (Fig. 4B). The expression of nestin and glutamic acid decarboxylase (GAD), the rate-limiting enzyme in GABA biosynthesis, increased over 7 days (Fig. 4B). As opposed to the epithelial morphology shown in Figure 1B, cells induced toward neural differentiation take on an elongated, neuronal morphology and react with antibodies to GFAP (glial cell lineage) and CNP (Fig. 4B, oligodendrocyte lin-eage). Nearly 90% of AE-derived cells were positive for GFAP, and 5% of cells were positive for CNP. These data indicate that under these culture conditions, AE cells are induced to differenti-ate to glial and neuronal cells.
Using culture conditions reported to induce cardiac differ-entiation of ESCs [25] (mesodermal lineage), we examined car-diomyocyte-related gene expression in AE cells. Results shown in Figure 3C indicate that cardiac-specific genes atrial and ventricular myosin light chain 2 (MLC-2A and MLC-2V) and the transcription factors GATA-4 and Nkx 2.5 are expressed or are induced in cultured AE cells over 14 days in media supple-mented with ascorbic acid. Immunohistochemical analysis of alpha-actinin expression is presented in Figure 4C. Although the staining pattern does not indicate the functional localization of α-actinin seen in mature cardiomyocytes, this staining pattern is very similar to that reported by Cheng et al. [26] with hESC-
derived cardiomyocytes.
Figure 3. Feeder cell–like function of basal layer amniotic epithelial (AE) cells. (A): Side-view image scheme of AE cell primary culture. After 5 days in culture, AE cells could be divided into three groups, a basal layer of cells that attached to the plastic dish (Adh), cells in an intermediate layer weakly adherent over the basal layer (Mid), and cells floating freely in the media (Sup). Cells in the intermediate layer were rounded-up single or small clusters of cells, many of which eventually form spheroid structures. (B): Semiquantitative mRNA expression analysis. The value was normalized by β-actin expression of each sample and shown with gene expression in the middle layer set to 100% (n = 3). The cell group (Mid) that attached on the basal layer cells expressed higher levels of the stem cell–specific marker genes Oct-4 and Nanog than the other two populations. (C): Flow cytometric cell surface antigen analysis. Cells were stained with the antibodies that recognize stem cell surface antigens SSEA-1, SSEA-3, SSEA-4, TRA 1-60, TRA 1-81, and Thy-1 (CD90) and analyzed by fluorescence-activated cell sorter. Values are mean ± SD (n = 4).
1556Multipotent Cells from Amnion
We also investigated hepatic (endodermal lineage) differ-entiation of AE cells by mRNA expression, protein production, and functional activity. mRNA expression of characteristic hepa-tocyte genes albumin and A1AT [27, 28] was examined by real-time quantitative PCR over time in culture (Fig. 5A). Steady and time-dependent increases in the expression of these genes were observed when cells were cultured in EGF and dexamethasone. Immunolocalization of albumin and hepatocyte nuclear factor 4-alpha (HNF-4α) revealed that up to 33% of cells were positive for albumin or HNF-4α (Fig. 5B). Some albumin-positive cells were binucleated and resembled normal human hepatocytes. Cells maintained in culture longer contained small cells with refractive cell junctions and characteristic hepatocyte morphology (Fig. 5B,
lower right). Although it could be argued that immunoreactivity Figure 4. Pancreatic, neural, and cardiac in vitro differentiation of AE cells. (A): Pancreatic differentiation of AE cells. One-step RT-PCR was conducted with the indicated primers on total RNA extracted from cells cultured for 14 days with media supplemented with nicotinamide (10 mM). The expression of the early pancreatic transcription factor PDX-1 and the downstream transcription factors Pax-6 and Nkx 2.2 and the mature hormones insulin and glucagon (Cy3, red) were identified. The photograph shows immunolocaliza-tion of glucagon expression with DAPI nuclear counterstaining in blue. Scale bar = 100 μm. (B): Neural differentiation of AE cells. Neural-specific gene expression was examined by one-step RT-PCR. GFAP immunostaining: more than 90% of the cells are GFAP-posi-tive (Cy3, red). Approximately 5%–10% of cells are positive for CNP (fluorescein isothiocyanate, green). DAPI nuclear counterstaining (blue). Scale bars = 100 μm. (C): Cardiomyocyte differentiation of AE cells. One-step RT-PCR for cardiomyocyte-specific genes from AE cells cultured for 14 days in basal media supplemented with ascorbic acid 2-phosphate. Immunofluorescent image with an anti–alpha-actinin antibody (Cy-3, red) and DAPI nuclear counterstaining (blue). Scale bar = 50 μm. Abbreviations: AE, amniotic epithelial; CNP, cyclic nucleotide phosphodiesterase; DAPI, 4,6-diamidino-2-phenylindole;GFAP, glial fibrillary acidic protein; Nkx 2.2, NK2 transcription factor–related locus 2; Pax-6, paired box homeotic gene 6; PDX-1, pancreas duodenum homeobox-1; RT-PCR, reverse tran-scription–polymerase chain reaction.
with albumin could be the result of cross-reaction with bovine serum albumin taken up from the media, the immunohistochemi-cal data are consistent with the expression of human albumin at the RNA level, and the antibody used for localization studies was made up in a solution containing 1% bovine serum albumin.
An important liver function is drug metabolism. Mature liver expresses basal and inducible CYP450 genes, which encode the drug metabolizing enzymes. Data presented in Figure 5C show the results of an assay for enzymatic activity for CYP1A conducted on AE cells and authentic human hepatocytes. After culture of AE cells with dexamethasone, hepatocyte-like cells express very high levels of the drug metabolizing enzyme CYP1A, with rela-tive levels equal to 60% of that found in normal human liver by the EROD assay [15] (Fig. 5C). The expression of CYP450 enzymes is considered a relatively late event in liver differentiation and demonstrates that AE cells can differentiate to cells that display mature liver functions.
Discussion
AE cells are anatomically and histologically specialized fetal epithelial cells that normally exist less than 10 months in nature. As shown here, the AE cells derived from term placenta seem to remain somewhat “plastic” in their differentiation options and maintain the capability to differentiate and contribute to cells from all three germ layers. The focus of these experiments was on the stem cell character of AE cells, and extensive differentia-tion protocols to each cell type were not attempted here; however, several markers of differentiation to each cell type are presented.
Miki, Lehmann, Cai et al. 1557
https://www.wendangku.net/doc/e013618762.html,
Although some of the genes examined for each cell type may also be expressed in relatively immature cells, the expression of genes characteristic of mature cells was also observed, including insulin and glucagon during pancreatic differentiation, CYP450 gene expression and robust CYP450 enzymatic activity in hepato-cyte-like cells, and CNP and GAD expression in neural cells. The markers of pancreatic differentiation are consistent with a recent paper describing the normalization of blood glucose in diabetic
mice transplanted with human AE cells induced to differentiate to Figure 5. Hepatic differentiation of amniotic epithelial (AE) cells. (A): Induction of hepatocyte-specific mRNA, albumin (n = 4), and α1-antitrypsin (A1AT, n = 3) over 3 weeks. Real-time quantitative polymerase chain reaction data are plotted relative to the starting material. (B): Immunohistochemistry with anti-human albumin (upper panel) on AE cells cultured for 14 days. Original magnifica-tion ×100 (upper left) and ×400 (upper right). Lower left, HNF4α staining. Mixture of cytoplasm-positive cells, nuclear-positive cells, and dead cells is observed. Lower right, a phase-contrast image of AE-derived hepatocyte-like cells after long-term culture (28 days). Scale bar = 100 μm. (C): Functional assay of drug metabolism by CYP1A, ethoxyresorufin-o-deethylase (EROD), conducted on naive AE cells, hepatocyte-like cells produced from AE cells, and freshly isolated human hepatocytes. CYP1A activity was induced by expo-sure to β-naphthoflavone (10 μM) for 48 hours before analysis.
insulin-expressing cells by culture with 10 mM nicotinamide for up to 4 weeks [29]. Data presented here suggest that only insulin RNA is present by 7 days in culture and that longer culture periods will be needed for insulin protein expression and secretion. Neural differentiation of AE cells was previously reported by Sakuragawa and coworkers [5, 30], who showed that under certain conditions, AE cells can mature to neuronal cells that synthesize and release several neurotransmitters, such as acetylcholine, norepinephrine, and dopamine [4, 5]. The RT-PCR data indicate that many of the neural genes were expressed in the AE cells derived directly from the amniotic membrane, indicating that the epithelial cells of the tissue express these genes even before they are placed into culture. Similar observations have been made with hESCs where basal levels of neural genes are present even in undifferentiated ESCs. The expression of early markers of hepatic differentiation such as albumin, A1AT, HNF4 expression, and basal and inducible CYP1A expression indicates that steps toward hepatic differen-tiation occur in media supplemented with dexamethasone. These data are consistent with previous observation by Sakuragawa et al. [31], who demonstrated albumin and alpha-fetoprotein expression in cultured AE cells, and with our previous report on the expres-sion of other CYP enzymes in cultured AE cells [32].
Because AE cells can differentiate to all three germ layers, we examined them with antibodies to well-known surface mark-ers characteristic of ES/embryonic germ/endothelial cells. The hESC line (H7) is approximately 40%–80% positive for the stem cell markers SSEA-3 and SSEA-4 [33] and do not express SSEA-1. Like hESCs, AE cells express SSEA-3 and SSEA-4 and do not express SSEA-1, although the relative proportion of SSEA-positive cells in initial isolates of AE cells is lower than that observed with hESCs. We speculate that more differentiated cells in the amnion may lose stem cell surface markers. In support of this hypothesis, stem cell marker genes were downregulated in isolated AE cells, which became adherent to the culture dish (Fig. 2), culture conditions also known to favor differentiation of hESCs. However, when AE cells are kept in high-density culture, spheroid structures developed. By using confocal microscopy, we observed that in long-term cultures, most stem cell surface markers were expressed on the spheroid structures. In addition to characteristic stem cell surface markers, AE cells express Oct-4 and nanog, transcription factors with an expression pattern pre-viously reported to be restricted to pluripotent stem cells [20, 21]. Both genes were readily detected in AE cells at the time of isolation, and their expression increased with time. As with the stem cell surface markers, the expression of Oct-4 and nanog was enriched in the cells maintained over the basal layer of more dif-ferentiated AE cells. These observations suggest that the basal layer of AE cells attached to the culture dish may play the role of an autologous feeder layer, serving as a substrate for attachment or possibly providing secreted factors which help induce or main-tain undifferentiated AE cells. An alternative explanation might
1558Multipotent Cells from Amnion
be that contaminating mesenchymal cells could proliferate in the AE cultures and provide feeder support. This possibility was examined by immunohistochemical analysis of cultures of AE cells maintained at confluence for 2 weeks. All cells reacted with antibodies to cytokeratins, whereas no cells could be detected with antibodies to alpha-smooth muscle actin or desmin, indicat-ing no contamination of these cultures with nonepithelial cells. It seems that the epithelial cells themselves support the stem cell characteristics of the cells growing attached to other cells rather than the culture dish substrate. In support of this hypothesis, Miyamoto et al. [34] report that feeder layers of AE cells can be used to maintain undifferentiated primate ESCs.
In the experiments reported here, AE cells did not form tera-tocarcinomas or other types of tumors in immunodeficient mice. In support of the conclusion that AE cells are not tumorigenic, there was no evidence of tumorigenicity when amnion membrane or membrane-derived cells were transplanted into patients. There was no evidence of tumorigenicity in humans when isolated amni-otic cells were transplanted into human volunteers to examine their immunogenicity or into patients in an attempt to correct lysosomal storage diseases [2, 35–38]. Unlike hESCs, human AE cells do not express telomerase and are not tumorigenic upon transplantation.
Placenta is abundantly available as a discard tissue after nor-mal delivery. Current statistics from the U.S. Census Bureau indi-cate that there are more than 4 million total births and more than 1 million cesarean sections performed in the United States per year. With an average yield of more than 100 million AE cells per amnion in our initial investigations (average, 100.25 × 106; stan-dard deviation, 81.8 × 106; maximum, 394.5 × 106; minimum, 1.8 × 106 cells; n = 48), large numbers of cells could be available from this source. In the presence of EGF, AE cells proliferate robustly. We estimate that 100 million AE cells could be expanded to 10 to 60 billion cells within six passages. Optimization of the culture conditions may allow even greater expansion.
There are recent reports of the detection of Oct-4–positive and mesenchymal stem cells in amniotic fluid [12, 39]. Those amni-otic fluid cells may come from lungs, skin, or other fetal tissues. Cytokeratin staining indicated that the cultures used in the stud-ies reported here were not contaminated with mesenchymal stem cells or other nonepithelial cells. The mesenchymal stem cells in the amniotic fluid are clearly derived from a source different from those used in our studies; however, these data reinforce the notion that even as late as the third trimester, there are Oct-4–positive, possibly pluripotent cells in the amniotic cavity.
We observed spheroid or embryonic body–like structures in high-density cultures of AE cells. Although these spheroids attached over the cells in the basal layer and express markers of pluripotency, the mixed nature of the cells in the spheroids is more analogous to that seen in neurospheres than to traditional embry-oid bodies produced from ESC s. Neurospheres have been shown to consist of a mixed population of neural stem and progenitor cells, whereby each sphere contains <1% neural stem cells and >99% progenitor cells [40]. Based on the expression of Oct-4, SSEA-3, TRA 1-60, or TRA 1-81, AE cell–derived spheroids may contain 10% stem cell marker–positive cells. These observations suggest that in terms of stem cell characteristics and differentiation poten-tial, AE-derived spheroids may be somewhere between pluripotent ESC clusters and multipotent neural stem/progenitor cell spheres.
Here we showed that AE cells from term placenta express sev-eral stem cell markers and have maintained some of the differenti-ation potential of their origin, the epiblast. Although the AE cells differentiate to all three germ layers, we do not describe these as stem cells because we have not shown long-term self-renewal and have not been able to grow the cells from single-cell clones. It took several years to optimize culture conditions for the clonal growth of hESCs, so we are optimistic that subsequent research may allow clonal analysis of AE cells. Additional work will be required to determine if the amnion is a heterogeneous mixture of progenitor cell with varied differentiation potential or if a single stem-like cell can give rise to all germ layers. Because the AE cells are available in such large numbers, even if separate cells from the amnion give rise to different cell types such as hepatocytes, pancreas, or cardiac muscle cells, that would not detract from the potential of the amnion as a source of cells for transplantation. When subsequent research reveals methods to efficiently propa-gate and differentiate AE cells toward cell types useful in clinical transplantation, amnion from discarded placenta may be an abun-dant, noncontroversial source of cells for regenerative medicine.
Acknowledgments
We thank Gerald Schatten and S.P.S. Monga for critical review of this manuscript and acknowledge support from the Alpha-1 Foundation and NIH/DK 92310, Liver Tissue Procurement and Distribution System.
Disclosures
T.M. owns stock in Stemnion and within the past 2 years has acted as a consultant for Stemnion.
References
1 Diwan SB, Stevens LC. Development of teratomas from the ectoderm of
mouse egg cylinders. J Natl Cancer Inst 1976;57:937–942.
2 Akle CA, Adinolfi M, Welsh KI et al. Immunogenicity of human amniotic
epithelial cells after transplantation into volunteers. Lancet 1981;2:1003–1005.3 Sakuragawa N, Tohyama J, Yamamoto H. Immunostaining of human
amniotic epithelial cells: possible use as a transgene carrier in gene ther-apy for inborn errors of metabolism. Cell Transplant 1995;4:343–346.
4 Elwan MA, Sakuragawa N. Evidence for synthesis and release of catechol-
amines by human amniotic epithelial cells. Neuroreport 1997;8:3435–3438.
Miki, Lehmann, Cai et al. 1559
https://www.wendangku.net/doc/e013618762.html,
5 Kakishita K, Elwan MA, Nakao N et al. Human amniotic epithelial cells
produce dopamine and survive after implantation into the striatum of a rat model of Parkinson’s disease: a potential source of donor for transplanta-tion therapy. Exp Neurol 2000;165:27–34.6 Romanov YA, Svintsitskaya VA, Smirnov VN. Searching for alternative
sources of postnatal human mesenchymal stem cells: candidate MSC-like cells from umbilical cord. Stem Cells 2003;21:105–110.7 Kogler G, Sensken S, Airey JA et al. A new human somatic stem cell from
placental cord blood with intrinsic pluripotent differentiation potential. J Exp Med 2004;200:123–135.8 In’t Anker PS, Scherjon SA, Kleijburg-van der Keur C et al. Isolation of
mesenchymal stem cells of fetal or maternal origin from human placenta. Stem Cells 2004;22:1338–1345.9 Fukuchi Y, Nakajima H, Sugiyama D et al. Human placenta-derived
cells have mesenchymal stem/progenitor cell potential. Stem Cells 2004;22:649–658.10 Takahashi K, Igura K, Zhang X et al. Effects of osteogenic induction on
mesenchymal cells from fetal and maternal parts of human placenta. Cell Transplant 2004;13:337–341.11 Tsai MS, Lee JL, Chang YJ et al. Isolation of human multipotent mes-enchymal stem cells from second-trimester amniotic fluid using a novel two-stage culture protocol. Hum Reprod 2004;19:1450–1456.12 In’t Anker PS, Scherjon SA, Kleijburg-van der Keur C et al. Amniotic
fluid as a novel source of mesenchymal stem cells for therapeutic trans-plantation. Blood 2003;102:1548–1549.13 Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell
lines derived from human blastocysts. Science 1998;282:1145–1147.14 Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from
human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000;18:399–404.15 Wen YH, Sahi J, Urda E et al. Effects of bergamottin on human and mon-key drug-metabolizing enzymes in primary cultured hepatocytes. Drug Metab Dispos 2002;30:977–984.16 Fujio K, Hu Z, Evarts RP et al. Coexpression of stem cell factor and c-kit in
embryonic and adult liver. Exp Cell Res 1996;224:243–250.17 Petersen BE, Goff JP, Greenberger JS et al. Hepatic oval cells express the
hematopoietic stem cell marker Thy-1 in the rat. Hepatology 1998;27:433–445.18 Tanaka S, Kunath T, Hadjantonakis AK et al. Promotion of trophoblast
stem cell proliferation by FGF4. Science 1998;282:2072–2075.19 Brivanlou AH, Gage FH, Jaenisch R et al. Stem cells. Setting standards
for human embryonic stem cells. Science 2003;300:913–916.20 Niwa H, Masui S, Chambers I et al. Phenotypic complementation estab-lishes requirements for specific POU domain and generic transactivation function of Oct-3/4 in embryonic stem cells. Mol Cell Biol 2002;22:1526–1536.21 Chambers I, Colby D, Robertson M et al. Functional expression cloning
of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643–655.22 Bonner-Weir S, Taneja M, Weir GC et al. In vitro cultivation of
human islets from expanded ductal tissue. Proc Natl Acad Sci U S A 2000;97:7999–8004.
23 Kukekov VG, Laywell ED, Suslov O et al. Multipotent stem/progenitor
cells with similar properties arise from two neurogenic regions of adult human brain. Exp Neurol 1999;156:333–344.24 Vescovi AL, Parati EA, Gritti A et al. Isolation and cloning of multipo-tential stem cells from the embryonic human CNS and establishment of transplantable human neural stem cell lines by epigenetic stimulation. Exp Neurol 1999;156:71–83.25 Mitsui K, Tokuzawa Y, Itoh H et al. The homeoprotein Nanog is required
for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003;113:631–642.26 Cheng L, Hammond H, Ye Z et al. Human adult marrow cells support pro-longed expansion of human embryonic stem cells in culture. Stem Cells 2003;21:131–142.27 Chinzei R, Tanaka Y, Shimizu-Saito K et al. Embryoid-body cells derived
from a mouse embryonic stem cell line show differentiation into func-tional hepatocytes. Hepatology 2002;36:22–29.28 Rambhatla L, Chiu CP, Kundu P et al. Generation of hepatocyte-like cells
from human embryonic stem cells. Cell Transplant 2003;12:1–11.29 Wei JP, Zhang TS, Kawa S et al. Human amnion-isolated cells normalize
blood glucose in streotozotocin-induced diabetic mice. Cell Transplant 2003;12:545–552.30 Sakuragawa N, Thangavel R, Mizuguchi M et al. Expression of markers
for both neuronal and glial cells in human amniotic epithelial cells. Neu-rosci Lett 1996;209:9–12.31 Sakuragawa N, Enosawa S, Ishii T et al. Human amniotic epithelial cells
are promising transgene carriers for allogeneic cell transplantation into liver. J Hum Genet 2000;45:171–176.32 Davila JC, Cezar GG, Thiede M et al. Use and application of stem cells in
toxicology. Toxicol Sci 2004;79:214–223.33 Henderson JK, Draper JS, Baillie HS et al. Preimplantation human
embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens. Stem Cells 2002;20:329–337.34 Miyamoto K, Hayashi K, Suzuki T et al. Human placenta feeder layers
support undifferentiated growth of primate embryonic stem cells. Stem Cells 2004;22:433–440.35 Scaggiante B, Pineschi A, Sustersich M et al. Successful therapy of Nie-mann-Pick disease by implantation of human amniotic membrane. Trans-plantation 1987;44:59–61.36 Tylki-Szymanska A, Maciejko D, Kidawa M et al. Amniotic tissue trans-plantation as a trial of treatment in some lysosomal storage diseases. J Inherit Metab Dis 1985;8:101–104.37 Yeager AM, Singer HS, Buck JR et al. A therapeutic trial of amniotic epi-thelial cell implantation in patients with lysosomal storage diseases. Am J Med Genet 1985;22:347–355.38 Sakuragawa N, Yoshikawa H, Sasaki M. Amniotic tissue transplantation:
clinical and biochemical evaluations for some lysosomal storage diseases. Brain Dev 1992;14:7–11.39 Prusa AR, Marton E, Rosner M et al. Oct-4-expressing cells in human
amniotic fluid: a new source for stem cell research? Hum Reprod 2003;18:1489–1493.40 Morshead CM, Benveniste P, Iscove NN et al. Hematopoietic competence
is a rare property of neural stem cells that may depend on genetic and epi-genetic alterations. Nat Med 2002;8:268–273.